header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13275
Transcript Name: lnx2b-202
Previous Names: lnx2b-003, zgc:85925-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031416 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031416|OTTDARG00000024013|ZDB-GENE-040426-2500 lnx2b|OTTDARP00000025522 lnx2b-003 LG_ BX247946.6 Danio rerio protein_coding KNOWN, 572 bp
GGCACGTCCTTGCATACACACACTCACATGCACAAACACA
CTCTGTCCCTAGTTGAGATGACGGGCTCTGGTTTCAGTCA
GGCTGCAGGCGGCCGGCGCAGCTGTTGGGCTTGAGTTTCT
TGTTTTCATGCAGCGGCTGCTAGGAGTCTGACTGCGCTGC
CATCTGAGAAACTTGGGTGTAGATGAAGCAGCTAGCAGAT
TGTTCTCTCTCTCTCTGGATTGGAAATATTTGGTTGCTTC
TCATCTGATGCAGCTGATGTAGAGTTTGTGAGCTGTGAAA
GAGGCGTAGGCTCTCCAGCCTAGCTCAACTTCTCCAGGCC
ATGACGGAGTCTAAGACGTCTTCACTGCCGACCGGTGTAA
CGTGGGCGCGGGTGTGTAAGGAATGTGGACAGTGCCATGA
TGGCCAAGACAGTCATCTGTTTGAATATCAGGATGAGGTG
GATGATGAGCTGGTCTGCCACATCTGCCTACAACCTCTGT
TGCAGCCTATGGACACACCGTGCGGCCACACTTATTGCTT
CCAGTGCCTCAGCAATTTCCTGCACGACCAGGACTTCTGT
CCTGTCGACCGC

lnx2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lnx2b-201 (1)    Ensembl 3150
lnx2b-202 572
ncRNA lnx2b-002 (1) 394
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lnx2b-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031416 (1),  Ensembl_Trans:ENSDART00000139159 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BI884607 (1) 530 bp
GenBank:CD593026 (1) 500 bp
CITATIONS (2)