Transcript

lnx2b-201

ID
ZDB-TSCRIPT-090929-13273
Name
lnx2b-201
Previous Names
  • lnx2b-001
  • zgc:85925-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031414 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031414|OTTDARG00000024013|ZDB-GENE-040426-2500 lnx2b|OTTDARP00000025521 lnx2b-001 LG_ BX247946.6 Danio rerio protein_coding KNOWN, 3150 bp
GAAAGCGTCAGATCCGACTTGTTTGTCTGAAACTCACGCT
GCTCACGTCGCCTACGGTTTAACAACACCTGGCGTGTTAT
ACTTATCAGACAATCCTCAGGGAAGTGATGAAATACTCAT
AGTATGCAGTTTAGTAGAAGTCACGACGGTTAATGTTTTA
TATTTGGAGTCGTCTTTGTTTTATGACTTCCGGAAAACCA
GCACAGAAACTTGGGTGTAGATGAAGCAGCTAGCAGATTG
TTCTCTCTCTCTCTGGATTGGAAATATTTGGTTGCTTCTC
ATCTGATGCAGCTGATGTAGAGTTTGTGAGCTGTGAAAGA
GGCGTAGGCTCTCCAGCCTAGCTCAACTTCTCCAGGCCAT
GACGGAGTCTAAGACGTCTTCACTGCCGACCGGTGTAACG
TGGGCGCGGGTGTGTAAGGAATGTGGACAGTGCCATGATG
GCCAAGACAGTCATCTGTTTGAATATCAGGATGAGGTGGA
TGATGAGCTGGTCTGCCACATCTGCCTACAACCTCTGTTG
CAGCCTATGGACACACCGTGCGGCCACACTTATTGCTTCC
AGTGCCTCAGCAATTTCCTGCACGACCAGGACTTCTGTCC
TGTCGACCGCCAAAGGATTCAGCTACAACAATGCAGAGCC
TCCAGCCTGCTGGTACGCAATCTGCTGGACAAACTGGCCG
TGCTGTGCCCGTTTCGCAGTGAGTGCGAGCTGAGCATGCA
ACGTTGTGAGTTGCAACCTCATCTGCACAACAGATGCCCT
GCGTTCAAGCGACTCAGGGAGGAGGCGGAGAGAAAAAAGA
GACCCTCCTGGAATGAGTTAAAGGGAAGTAAATCAGATGG
AGATTTAGCTGATGCCAAATCTGCCCAAACAATCGGACGC
ACAGCTCAGCTCAGCGCACCCTCAGAACCTGGACTGGTCA
ACCCCGCCTTCGAGGAGGGCGAAGATGACACCCCTCTGAG
GTGCAGTCTTGTGGCTGAGGCGACTGTGGTGGAGCTGTTT
CGTGAAGATCCAGGCGAGGATTTGGGATTGCGTATAGTGG
GAGGAAAAGACACGCCCTTGGGCAACATCGTCATTCAGGA
GATCGTGCGTGACTCACTGGTGGCCCGAGATGGCAAACTG
GCACCTGGAGATCATATCCTGGAGGTGAATGATGTCAGTC
TGGCATCTATCTCTCACAGTCGTGCCATTGCTGTGATTCG
GCAGCCGTGTTCCCGCCTCAGGCTCACTGTCATGCAGGAG
AAGGGCTTCAAACCCCGGCCCGAACATCACACTCAGCCCT
CAGCTTCACCTCCAACACAGTCACCCAGTACCAACCAGAA
CCACGGTACTGTCATCCAGGTCACCCTGGTGAAGCATGAG
CGTTCAGAGGCGCTTGGCATCAAACTCATCCGCAAGTCTG
AGGAGCCAGGAGTTTTCATCCTGGACCTTCTCCCTGGAGG
ACTGGCGGCCAAAGATGGCAAATTGAGGAACAACGATAAA
GTGCTGGGCATTAATGGACAGGACCTGCGACATGGCACCC
CAGAGAGTGCAGCTCAGATCATACAGGCAAGTGAAATGCG
TGTGAACTTTGTAGTGATGAGGCTTCAAGATGTCTCCGAG
GAGGGTGGTGAGGGACAGAGCAGAGGGGCCCGGAGAGTCC
CCGAACCACAGTATTTCAGACGCCACTCTGAATACATGAA
GGAGCCTCCAGGCGGATTCTCCAGTCAAGAGAAGACTGTG
ACCCTAAAGAAGGAGCCTCGGCAGTCTCTAGGCATCACCA
TTGCAGGTGGCAGAGACTGTCGCAGCCGTTTGCCTGTCTA
CATCACTAGTGTTCAGCCTGTGGGCTGCCTGCACAGAGAC
GGCACCGTCAAAACAGGTGATGTTCTTTTGAGTATAAATG
GTATTGACCTGACCCATCTGACCTACAACGAGGCAGTGAC
TGTCCTGAAGACCCAGACTGCTCAAAGCACAGTAACGCTG
CGAGTCATCCAGACGTTTGCTGATGACGAAGAACAGGATG
GAGAATCTGGCAGTAGAGAAGACATGGACACAATGGAGGG
CCCCAAAGATGATGACATCAACTGGGTTCCTCTCTGGACC
CGCTGGCTCGGGCTGCCCAGTTGCATCCACTGGTGTCGAG
ATATAATGCTGATGAAGACCAACAGTGAGAGCTGGGGCTT
CAGTATTGTGGGAGGATATGAGGAGAGTCGTGGCCAACAG
CCCTTCTTCATCAAGACCATTGTGCCTGGAACACCAGCTT
ACTTTGACGGACGCCTCAAGTGTGGTGATGAGATTGTGGC
AGTGAATGGAGTCACTACAGTGGGCATGAATAACTCCTCC
TTGATACCCATGCTGAAACTGCAGAAGAACAAAGTCACTC
TGACCGTGGTCTCCTGGCCTGGCAGTCTGGTTTAAAACTC
AACCATAACAAGCATTTAAAGCTGCAGCACAAGTCTAATA
CTGGAGCATTGAGTGCTCTTGTGGAAAAAGGTGGCACATC
GACACTGATTTTATATTATTTAATCCACTGTAGTTCACAG
TTCTTCACAAGTGTGTAATGCTCTTTGCTAGGCACCGATA
GTGTAAGAAGTGCATATAAGGACACTGAACAAGCTTTCAA
AAGACATTTTAAACTAGATATTTACCATGCAAGAGGCATA
TTTTAGTACAGAACGTCTCGTTTTCATTGATGATCTTTTA
GAAGGTTTGTGATCGACATGAATAGGTCAGTAGTGAGGTC
ATCATTATTTTGACACTACCTAGAGTTGCACACGTTCTCA
TGTTGGTGAGCATTTTCACTCTGCAATATGTTCTGAGAAT
GGTTACGCTAGCGTGAAGCTCAGTAGTTGCTGTTGGGGTG
ATAAAGTTAGACGTTTTCTAAATCCACAGCTTTGCTTGTT
CGACACATTTTTAAGAATGTATCTCTTGGGTGCCTTGGAT
ATAAATATGTACAAACGCGGTGATCCACACCTGCCTTAAT
TGCCTGTACACCAAAAATGCCATTCATTCTCTTTGGCCTT
TTATCATCTGTAGAGCGGTTGTTTGAATGCTTTTAGTTTT
TTTTTTTCTTTCGTATACATGTATGTTTGACCCTTTCACT
TTTAGCCAGATGTCAAGTCTCGAAAGGGTTACTATGATGA
CAGAATTAAAGATTTAGATTTATTTTATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations