Transcript

lnx2b-002

ID
ZDB-TSCRIPT-090929-13274
Name
lnx2b-002
Previous Names
  • zgc:85925-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031415 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031415|OTTDARG00000024013|ZDB-GENE-040426-2500 lnx2b|no_translation lnx2b-002 LG_ BX247946.6 Danio rerio protein_coding KNOWN, 394 bp
CGAGTTTCGGTCTTGAGCGCGAAATGTCCAACGCGTTTCA
TTTCTTACATGACACATCAATACTCGCAATATTTGCTTTA
CCTTCCAGTTGTAAGCTACATTTGGTGCTTTAGTATCACT
ACAAGCTGGATAAATGAAGGTATTTCAAGGGCACTCGGTT
GTCCAGGTTACAGTCGGAATCTCCTGTCAGCTGATTGATG
AATGATTTATGGCTTCTACTTTCTCGTGTGTCTCATCTAC
CTGCAACGTGTAGGTCAGACCGCCATTTCAGAAGAAACTT
GGGTGTAGATGAAGCAGCTAGCAGATTGTTCTCTCTCTCT
CTGGATTGGAAATATTTGGTTGCTTCTCATCTGATGCAGC
TGATGTAGAGTTTGTGAGCTGTGAAAGAGGCGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations