header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13274
Transcript Name: lnx2b-002
Previous Name: zgc:85925-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000031415 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000031415|OTTDARG00000024013|ZDB-GENE-040426-2500 lnx2b|no_translation lnx2b-002 LG_ BX247946.6 Danio rerio protein_coding KNOWN, 394 bp
CGAGTTTCGGTCTTGAGCGCGAAATGTCCAACGCGTTTCA
TTTCTTACATGACACATCAATACTCGCAATATTTGCTTTA
CCTTCCAGTTGTAAGCTACATTTGGTGCTTTAGTATCACT
ACAAGCTGGATAAATGAAGGTATTTCAAGGGCACTCGGTT
GTCCAGGTTACAGTCGGAATCTCCTGTCAGCTGATTGATG
AATGATTTATGGCTTCTACTTTCTCGTGTGTCTCATCTAC
CTGCAACGTGTAGGTCAGACCGCCATTTCAGAAGAAACTT
GGGTGTAGATGAAGCAGCTAGCAGATTGTTCTCTCTCTCT
CTGGATTGGAAATATTTGGTTGCTTCTCATCTGATGCAGC
TGATGTAGAGTTTGTGAGCTGTGAAAGAGGCGTA

lnx2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA lnx2b-201 (1)    Ensembl 3150
lnx2b-202 (1)    Ensembl 572
ncRNA lnx2b-002 394
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lnx2b-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000031415 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD604690 (1) 392 bp
CITATIONS (1)