header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12991
Transcript Name: itgb5-203
Previous Name: itgb5-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030899 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030899|OTTDARG00000023664|ZDB-GENE-030131-6022 itgb5|OTTDARP00000028967 itgb5-004 LG_none CR391951.5,CR391905.6 Danio rerio protein_coding KNOWN, 767 bp
GTTTAAAGTAATGTGAGGGACGCTGGCAGGACACTCGACT
ATTGAACTTCCAAGCTGAAAACAACCGGAGGAACGAGGAA
AACAGCCTGTTCAATAAGTTTGAAATGTTCGTGCAACTGA
AGATTTAAAACCCAGTATGAATGCTGGGCAAGTTGCATTA
CAGCAGTGGACCTCGGACAGAGAGCGACAGTAACTTCGAG
TGTGTGGATTATTGTTACAGGATCACTCGGATTTCACTCA
TGTGTTTACAGTGCAGATTCGCGCACTGGACACTCACTTC
AGTCATGTATGTGCCGCTGTGATTTGGGAAGGATGGACAA
AGAGAAGATCTCGGTTACCCGCTGTGGAAGGATGTGGAAA
CTTTGCTCATCTACACGCCACCCGGCTCTTCTAGTTTGTA
TAGTGTTAGAAATATTTATTCACAGCGTCAAAGGTCTTAA
TGTTTGTATGAGCGGCAGCGCCACGTCTTGTGAAGAGTGT
CTCCTCATTCACCCGAGCTGCGCCTGGTGCGCGCAAGAGG
ACTTTGGACAGGCCAGAACACTTACCTCAAGATGTGACTT
TAGCCAGAACTTGCAGAAGAGGGGATGCGATGCACCATTT
ATAGAGAACCCGAGGAGTGGCAGCTCTGTGCTCCAGAGCA
AACCCTTGAGCTACAAAGGGTCAGGAGTGACCCAGTATGA
TGTCATCCAGATATACCCACAGAAGATCTCTCTCAGCTTA
AGGCCTGGTGACCAGGCGTCTTTTGAAGTCCAAGTGCGCC
CTGTGGA

itgb5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA itgb5-002 (1) 1967
itgb5-003 (1) 375
mRNA itgb5-203 767
itgb5-204 (1) 3427
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itgb5-203 Contained in:
OTHER itgb5-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030899 (1)
  • Ensembl_Trans:ENSDART00000131429 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AW174119 (1) 735bp
    GenBank:BM103247 (1) 597bp
    CITATIONS (2)