header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12988
Transcript Name: itgb5-204
Previous Name: itgb5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030896 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030896|OTTDARG00000023664|ZDB-GENE-030131-6022 itgb5|OTTDARP00000025152 itgb5-001 LG_none CR391951.5,CR391905.6 Danio rerio protein_coding KNOWN, 3427 bp
TGAACTTCCAAGCTGAAAACAACCGGAGGAACGAGGAAAA
CAGCCTGTTCAATAAGTTTGAAATGTTCGTGCAACTGAAG
ATTTAAAACCCAGTATGAATGCTGGGCAAGTTGCATTACA
GCAGTGGACCTCGGACAGAGAGCGACAGTAACTTCGAGTG
TGTGGATTATTGTTACAGGATCACTCGGATTTCACTCATG
TGTTTACAGTGCAGATTCGCGCACTGGACACTCACTTCAG
TCATGTATGTGCCGCTGTGATTTGGGAAGGATGGACAAAG
AGAAGATCTCGGTTACCCGCTGTGTAAAAATCATATATCT
ATAATAACTTAGTTTTATACTATTGTACAAAAGGAAAACT
ACGTTTGGCGCTGAACTGTGTTTGGACTTCGCAGGGAAGG
ATGTGGAAACTTTGCTCATCTACACGCCACCCGGCTCTTC
TAGTTTGTATAGTGTTAGAAATATTTATTCACAGCGTCAA
AGGTCTTAATGTTTGTATGAGCGGCAGCGCCACGTCTTGT
GAAGAGTGTCTCCTCATTCACCCGAGCTGCGCCTGGTGCG
CGCAAGAGGACTTTGGACAGGCCAGAACACTTACCTCAAG
ATGTGACTTTAGCCAGAACTTGCAGAAGAGGGGATGCGAT
GCACCATTTATAGAGAACCCGAGGAGTGGCAGCTCTGTGC
TCCAGAGCAAACCCTTGAGCTACAAAGGGTCAGGAGTGAC
CCAGTATGATGTCATCCAGATATACCCACAGAAGATCTCT
CTCAGCTTAAGGCCTGGTGACCAGGCGTCTTTTGAAGTCC
AAGTGCGCCCTGTGGAAGACTATCCTGTTGATTTGTACTA
CCTCATGGACCTCTCGCTATCCATGAAGGACGATCTGGAC
ACGATCCGCAACCTGGGCACCAAGCTGGCTGAAGAAATGA
GGAAGCTCACGAGTAACTTTCGTCTTGGGTTTGGTTCCTT
TGTGGACAAGAACATCTCACCCTTCTCCTACACTGCATCC
AAGTACCAGGACAACCCATGCAATGGATATAAATTGTTCC
CAAACTGCGTCCCAACATTTGGCTTTCGTCACCTCTTGTC
TCTTACGGACAAGGTTGATCGTTTCAATGAAGAAGTGCAG
AAGCAGATGGTTTCGAGAAACAGGGACGCGCCAGAGGGAG
GGTTTGATGCCATTCTTCAGGCTGCAGTTTGCAGGGAGAA
GATTGGCTGGAGGAAGGAGGCCTATCATCTGCTGGTGTTT
GCCACTGATGACGTCCCTCACTTGGCTTTGGATGGTAAAC
TCGGTGGACTGGTGCATCCTCATGACGGCCAGTGTCACCT
GAATGACAAGAATGAGTACAGTGCTTCAACCAAGATGGAC
TATCCTTCTCTGGCACTGCTTGGAGAAAAACTGGCTGAAA
ACAATATTTTCCTGATCTTCGCTGTTATAAAAAGACACTA
CGTTCTTTACAAGAACCTCACTGCGTTGATCCCTGGGACT
ACAGTGGAAATTTTGGACCAGGACTCCAAAAACATCATTC
AACTAATTGTGAATGCCTACAATAACATAAGGTCAAAAGT
TGAGCTGAGCGTGTGGGATCATCCTGAAGATCTCAGTCTG
GCCTTCTCCGCTACCTGTCAAGATGGACAGCCCCTGACCG
GTCTCCGCAAGTGCGCCGACCTCAAAATTGGTGACACTGT
CTCCTTCAATGTAACTGTAGACGCTCGAGGATGTCCTCCG
AAAGGCACCAGGAAGAGTTTCACCATCAGGCCTGTTGGTT
TTAAAGACCGTCTAGAGGTTTCTGTGGATTACCGCTGTGA
TTGCCGCTGCACGTATCACACAAAGCCGAACAGCAGCCGC
TGCAACTCTGCTGGCACTTACAACTGTGGGTTGTGCCGGT
GTGAGCCTGGGTATCTGGGAGCCCGCTGCGAGTGCCAGGA
GGGTGAGGTGGACCACCAGCACCTCAGTGCCTGTCGAGAA
GCAGAGGGCAAGCAGGTGTGCAGTGGTCGTGGAGAATGCA
GCTGTAACCAGTGCCTGTGCTATGAGTCAGAGTTTGGCAA
GATCTACGGCACCTTCTGCGAATGTGACGACTTCTCCTGT
GCCCGACACAAGGGCATACTCTGCTCAGGTAAGATAAAAT
CAGGTCATGGAGAATGCCACTGTGGTGAGTGTAAATGCCA
TGCCGGTTATATTGGAGACAACTGTAATTGCTCGACGGAA
ACGGCTTCCTGTGTGTCGGATGATGGCAAGATCTGTAGCG
GCCGGGGCAGCTGTGTGTGCGGACGCTGCCAGTGCACTGA
ACCAGGGGCATTTGGGGACACATGTGAAAAATGTCCCACC
TGTCCAGATGCATGTGGAACAAAGAGGGAATGCATCGAGT
GTCGTCTTTTTAACACAGGAAGACTGGCTGATAATCAGAC
CTGTCAGCGCATGTGCAAGGACGAAATCACCACAGTGGAA
ACCCTCAAAACTGACGATCCCAACGCTGTTCAGTGTGTGT
ATAAGACTGAGAATGACTGCGTGATGAAGTTTACATACTC
TGAACATGCCAATGGACAATCAGTCCTCACCGCTCTTAAA
GAGCCAGAATGTGCCGTCGCACCAAATGCTATGACCGTGC
TGCTGGCTGTGGTTGGCAGTATCTTGTTGATGGGCATCGT
GCTACTGGCTCTCTGGAAACTGGTCATCACTGTTCATGAC
CGCAGGGAGTTTGCACGCTTTCAAAGTGCACGTTCACGAG
CGCGATATGAGATGGCATCTAATCCAGTTTATAAGCGGTC
CGTACCAATGGAGACGGATTTCGATATGCATGGTATCAAG
TCACTGAACGGAGGAGTCCACTGATTAAACACCATTTGGA
CTGAGGGACATGGCAGGACCTGTCCGGTGCACATCTGCAC
TACAGTGGAGCACAGAGATGGGATGGATTTTATGGTCTGA
TGCAATGAAAACTTTTTGGTGGATTAGTGGTTCATGAGGA
TTGGAGATAACAGTAATGAAAGTCAATTTATGAGCGGCAT
TTGGACACATGCTGAATTTGAGAAAAGGATTTTAAGGGCT
TGCCCGCTTGACTTCGTGAGCGATGGACATTGACCCACTA
TGGACCGCTTGCTTGAATATAATTCGTCATTGTCTTCATT
TCTAACCGTACCTCCCACACATTATGATGGATTTTGCAGT
GCATTCTTTTATAGGCAAAAAGACAAGTGTATATTTTTTA
ACATTGTGCCTTTCCAAGCCGTGACACTTTTTATGGGAAT
TAAATATATTTACATGTGACATTGTACAGTAGACATAATA
GAAAACAAACAAATGCAAACTTTACATCAGCTCTTTAATG
AAGAGAAGGGTACTAACATGACCAGAGCAATAACGGTCTT
AACTCTTTTTTGCACGTTGTTTATTAGGTTGAGGTTTATA
AAGTAAAAAAGTCACTCTACAATGAAA

itgb5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA itgb5-002 (1) 1967
itgb5-003 (1) 375
mRNA itgb5-203 (1) 767
itgb5-204 3427
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itgb5-204 Contained in:
OTHER itgb5-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000030896 (1)
  • Ensembl_Trans:ENSDART00000138148 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC139895 (1) 3431bp
    GenBank:EF412963 (1) 1023bp
    GenBank:EE319002 (1) 900bp
    GenBank:DT862899 (1) 837bp
    GenBank:DT069707 (1) 813bp
    GenBank:DT870472 (1) 785bp
    GenBank:CO349825 (1) 730bp
    GenBank:BM104079 (1) 677bp
    GenBank:BG892235 (1) 631bp
    GenBank:BI884761 (1) 574bp
    GenBank:BI884805 (1) 387bp
    CITATIONS (2)