ZFIN ID: ZDB-TSCRIPT-090929-12990
Transcript Name: itgb5-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030898 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030898|OTTDARG00000023664|ZDB-GENE-030131-6022 itgb5|no_translation itgb5-003 LG_none CR391951.5,CR391905.6 Danio rerio protein_coding KNOWN, 375 bp
AGAACCTCACTGCGTTGATCCCTGGGACTACAGTGGAAAT
TTTGGACCAGGACTCCAAAAACATCATTCAACTAATTGTG
AATGCCTACAATAACATAAGGTCAAAAGTTGAGCTGAGCG
TGTGGGATCATCCTGAAGATCTCAGTCTGGCCTTCTCCGC
TACCTGTCAAGATGGACAGCCCCTGACCGGTCTCCGCAAG
TGCGCCGACCTCAAAATTGGTGACACTGTTAGTACTTTAC
ACTTTACTACACAATGTGTCTTTTCAAATGGGTTAAAAGG
GAGCAAAGCTGATCCTGTCTCTCAGTCTGCAACCTGAGTG
TTTGATGTGTTGTCTGGCAAGAAGCTGGACTCTTATTTAT
ACTTCTTGGATTGAA

itgb5 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA itgb5-203 (1)    Ensembl 767
itgb5-204 (1)    Ensembl 3427
ncRNA itgb5-003 375
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
itgb5-003 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030898 (1),  Ensembl_Trans:ENSDART00000145263 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL924452 (1) 380 nt
CITATIONS (2)