Transcript

ctsla-203

ID
ZDB-TSCRIPT-090929-12432
Name
ctsla-203
Previous Names
  • ctsl1a-003
  • ctsla-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030176 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030176|OTTDARG00000023199|ZDB-GENE-030131-106 ctsla|OTTDARP00000024590 ctsl1a-003 LG_ CT025745.13 Danio rerio protein_coding KNOWN, 768 bp
GAAGCTGTGGGCTGCGACCGGCCAGATCCCGTGACTGCAG
CAGATCAGACACACCAGGAACATTGTATTCTTTTCTGTTC
CCAGACCAGTGTTTCTGTCTTGAGGCCCGGGTAAACAAAC
GTATTTTTAGACTAAGTTATATACAGATTGTTTTCATCAT
GAGGGTGTTCTTGGCTGCTTTTACCTTGTGCCTCAGCGCT
GTGTTCGCTGCTCCTACTTTGGACCAGCAATTAAATGATC
ATTGGGATCAGTGGAAGAAATGGCACAGTAAAAAATACCA
TGCAACAGAGGAAGGGTGGAGAAGGATAATCTGGGAGAAA
AACTTGAAAAAGATTGAAATGCACAATCTGGAGCACTCCA
TGGGCATACACACCTACAGACTCGGAATGAACCACTTTGG
AGACATGACTCACGAGGAGTTCAGACAGGTGATGAATGGT
TTCAAACACAAGAAAGACAGACGATTCAGAGGATCCCTGT
TCATGGAGCCCAACTTCATTGAGGTCCCAAACAAGCTGGA
CTGGAGAGAGAAGGGATATGTGACTCCTGTGAAAGATCAG
GGTGAGTGTGGTTCTTGCTGGGCTTTTAGCACAACCGGAG
CCCTGGAGGGTCAGATGTTCAGGAAGACTGGAAAATTGGT
GTCTTTGAGCGAGCAGAACCTGGTGGACTGCTCCCGTCCT
GAAGGCAATGAGGGCTGCAACGGAGGTCTCATGGACCAGG
CCTTCCAGTACGTCAAGGACCAGAATGGTCTCGACTCTGA
GGAATCCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations