Transcript

ctsla-204

ID
ZDB-TSCRIPT-090929-12431
Name
ctsla-204
Previous Names
  • ctsl1a-002
  • ctsla-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030175 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030175|OTTDARG00000023199|ZDB-GENE-030131-106 ctsla|OTTDARP00000024589 ctsl1a-002 LG_ CT025745.13 Danio rerio protein_coding KNOWN, 947 bp
GTCAAGATTTATTTTGCTTTATTTACAGAACATGAGCTTG
TTTAGGTCGTTCTCTTATTGAGGCTCTTGCAAAATATGTT
TTGTGATCAACGTTATTTCTTCCGTCGACGCACGGCTTTA
ACGTTACCTTATTTACTAATGATTTAGCGTTTTCCGCTAT
AACAGTGGATTTTGAAATCGTTTCAATAGTTTCTTTTTCG
ATTTCCGTGGCCTGGTTTCGGTCTTTGTTTTCTTTTCCTG
GGAAGCTGTGGGCTGCGACCGGCCAGATCCCGTGACTGCA
GCAGATCAGACACACCAGGAACATTGTATTCTTTTCTGTT
CCCAGACCAGTGTTTCTGTCTTGAGGCCCGGTGTTTTCAT
CATGAGGGTGTTCTTGGCTGCTTTTACCTTGTGCCTCAGC
GCTGTGTTCGCTGCTCCTACTTTGGACCAGCAATTAAATG
ATCATTGGGATCAGTGGAAGAAATGGCACAGTAAAAAATA
CCATGCAACAGAGGAAGGGTGGAGAAGGATAATCTGGGAG
AAAAACTTGAAAAAGATTGAAATGCACAATCTGGAGCACT
CCATGGGCATACACACCTACAGACTCGGAATGAACCACTT
TGGAGACATGACTCACGAGGAGTTCAGACAGGTGATGAAT
GGTTTCAAACACAAGAAAGACAGACGATTCAGAGGATCCC
TGTTCATGGAGCCCAACTTCATTGAGGTCCCAAACAAGCT
GGACTGGAGAGAGAAGGGATATGTGACTCCTGTGAAAGAT
CAGGGTGAGTGTGGTTCTTGCTGGGCTTTTAGCACAACCG
GAGCCCTGGAGGGTCAGATGTTCAGGAAGACTGGAAAATT
GGTGTCTTTGAGCGAGCAGAACCTGGTGGACTGCTCCCGT
CCTGAAGGCAATGAGGGCTGCAACGGAGGTCTCATGGACC
AGGCCTTCCAGTACGTCAAGGACCAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations