Transcript

ctsla-004

ID
ZDB-TSCRIPT-090929-12433
Name
ctsla-004
Previous Names
  • ctsl1a-004
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030177 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030177|OTTDARG00000023199|ZDB-GENE-030131-106 ctsla|no_translation ctsl1a-004 LG_ CT025745.13 Danio rerio protein_coding KNOWN, 878 bp
GTGTTTTCATCATGAGGGTGTTCTTGGCTGCTTTTACCTT
GTGCCTCAGCGCTGTGTTCGCTGCTCCTACTTTGGACCAG
CAATTAAATGATCATTGGGATCAGTGGAAGAAATGGCACA
GTAAAAAATACCATGCAGTGAGTGTCTAAAGCTCATCGTT
TATTTCCAGTTTACATCCATTGAATGAAGAACTGTTGAAC
ATTTTGCTTTCTCTTAACAGACAGAGGAAGGGTGGAGAAG
GATAATCTGGGAGAAAAACTTGAAAAAGATTGAAATGCAC
AATCTGGAGCACTCCATGGGCATACACACCTACAGACTCG
GAATGAACCACTTTGGAGACATGGTATGATTGCAAAAGTT
GTTTGTATAAGGCGTTTGCATATTGATTTTATGAAATTCC
TTCAGCATTTTAGCTAAATTTTTCTGTGTCTGCAGACTCA
CGAGGAGTTCAGACAGGTGATGAATGGTTTCAAACACAAG
AAAGACAGACGATTCAGAGGATCCCTGTTCATGGAGCCCA
ACTTCATTGAGGTCCCAAACAAGCTGGACTGGAGAGAGAA
GGGATATGTGACTCCTGTGAAAGATCAGGGTGAGTGTGGT
TCTTGCTGGGCTTTTAGCACAACCGGAGCCCTGGAGGGTC
AGATGTTCAGGAAGACTGGAAAATTGGTGTCTTTGAGCGA
GCAGAACCTGGTGGACTGCTCCCGTCCTGAAGGCAATGAG
GGCTGCAACGGAGGTCTCATGGACCAGGCCTTCCAGTACG
TCAAGGACCAGAATGGTCTCGACTCTGAGGAATCCTACCC
CTACCTGGGAACTGACGATCAGCCCTGCCATTTTGATCCC
AAAAACAGCGCAGCAAATGACACCGGATTCGTTGACAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations