header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12107
Transcript Name: hps1-002
Previous Name: zgc:123240-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029727 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029727|OTTDARG00000022907|ZDB-GENE-051113-152 hps1|no_translation hps1-002 LG_ BX294129.10 Danio rerio protein_coding KNOWN, 827 bp
AGATGGCTGAGGACAGTCTACAAACTCTTGAAGTTTCAAC
CCCTGACCCTTCATCGCCGTCAAGAGTGTTTCTGGAAGCC
AAAGAGTGTCCCATGATGCCTCACTCCATGTATTGCCTGT
CTCTATGGCCTGGTATCACACTAGTGCTGCTCACCAAGAT
CCCCAACAGTCATATGGCGGTGTCGGTTTACTACTTTCTG
GAGGCTTTCGTCAAGCTGGAGAAGAGGTTAGGTGAGGGCC
ATGAAGGGGCTTCAGCCATGCGGGGTCAGTCCTCTGTCCA
GGAGCAGCGGAGCAAACTGGAGAAGTTCATTAAAGCCTGG
TCCAGCATGGAGATTCAGACTTTGCAACTCCAAAATGCTT
GGACAGACTTTAAGAACAAGGCCTTCAGCAGATCTGGGAC
TGGATTTACTAGAGATTTGCTGCCGTCTTGTAGAAACATG
AAGACTCAGCTGTGTGGTGTGTACAGGCAGTTTTTCGCAG
CTGAATGTATGGGCAGCAGTCAGCGGTTGGCTCCTCATCT
GCAAGAACGGGCTCTGAACATGGTCCAGTATGTCTGAAAA
GATAACGCTTTAAGTTGATGAATATTATGTGCTTTAGAAA
CAAAGGGTTAGTTCACCTAAAAATGTCCAATCCCCTGAGA
CTTTTGTACATATTCAGAACACAAATTAAGCTATTTTAGA
TGAAATCCAGGAGCTCTCTAACCCTTGGTAGACAGCAAAG
GTCACAAGTCATTCAGAAAATGAACCAAATATATTGTCGA
GGTATTCCATGTTACTTGAGTGGTTCAAGTGTAATCATAT
GAAGCTCCATGAACACTTTTATGCACC

hps1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hps1-002 827
mRNA hps1-201 (1) 4642
hps1-203 (1) 310
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hps1-002 Contained in:
[BAC] DKEYP-34H12 (1)

OTHER hps1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029727 (1)
  • Ensembl_Trans:ENSDART00000143506 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH472040 (1) 826 bp
    CITATIONS (2)