ZFIN ID: ZDB-TSCRIPT-090929-20646
Transcript Name: hps1-203
Previous Names: hps1-003, zgc:123240-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000040516 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000040516|OTTDARG00000022907|ZDB-GENE-051113-152 hps1|OTTDARP00000032376 hps1-003 LG_ BX294129.10 Danio rerio protein_coding KNOWN, 310 bp
GCGTCTCGGAAGCTCATCGGCGCCATCTTGTGCAAGTAGC
CTAGGGGGAGATCGCACACGGCATCAGATGAGGCGTAAAC
TTTAGTTTCATCCTGGAGGAACCAAAAGCTGTCGGCTTCT
GAGGAACACCCTGTCAGGTAAAATGAAGTGTCTGCTGGTG
GCCAATGAGAGCGCAGAGGTTCTGTTCTACTGGACGGACA
GCGAGTTCGAACAGCGGCTTCAGGAGCAGTATGGAGTCTC
CCAGGAGGAAGGAGAAGGACTGCCTGCCTTTGAAGACAGC
ATTAACACTCTCTTCGCACCAATCATCATC

hps1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hps1-002 (1) 827
mRNA hps1-201 (1) 4642
hps1-203 310
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hps1-203 Contained in:
[BAC] DKEYP-34H12 (1)
OTHER hps1-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000040516 (1)
  • Ensembl_Trans:ENSDART00000146112 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK681946 (1) 314bp
    CITATIONS (2)