header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-12106
Transcript Name: hps1-201
Previous Names: hps1-001, zgc:123240-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029726 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029726|OTTDARG00000022907|ZDB-GENE-051113-152 hps1|OTTDARP00000024259 hps1-001 LG_ BX294129.10 Danio rerio protein_coding KNOWN, 4642 bp
TTACGGAAGCGCTGTAGCAGTTCAGCAGCTGATGACAAAC
TAATCGTTGTTCGGTGAGCTGGACCAGGATTCAGAAACAA
TGACACTTTTCTGCTGTAAACGCCAACAGCTAAAACAGCA
TCAGATGAGGCGTAAACTTTAGTTTCATCCTGGAGGAACC
AAAAGCTGTCGGCTTCTGAGGAACACCCTGTCAGGTAAAA
TGAAGTGTCTGCTGGTGGCCAATGAGAGCGCAGAGGTTCT
GTTCTACTGGACGGACAGCGAGTTCGAACAGCGGCTTCAG
GAGCAGTATGGAGTCTCCCAGGAGGAAGGAGAAGGACTGC
CTGCCTTTGAAGACAGCATTAACACTCTCTTCGCACCAAT
CATCATCTCCTGTAGCACCATGGTGGACCGACTCGGGGAC
AATTACACCTCCTTCAGCACAGAGAACAATCATATCTATG
TTCTGCATCAGTTTGATGAGTGCCTGTACATCGCTGTGAA
CGGAGACGGAGAGGAGACCGAAGAGGATTTGAAGAGAAAG
ATCTACGTGATGAAGAAACTCACAGAAATCCTGTTTGGGA
TGGTGACGCTCAGCGGCCCCCTCCTGAGGAAAGAACTGCG
CCCTCAAGACACAGAGCAGAGGAACCGGTTGTGGAAAAAA
CTGCGAAGCCTCTTGGAGACATACAGCCGCTTGCGTGAAA
ATGACCAAAGCTTTTTAGTGGAGGCAGTGGAGAGGCTGAT
CCACCCGACCCTTTGTGAGCAGTGCATTGAGTTTCTGGAG
CGTCGACTGGTACAGCAGATTAACAGCAGCATGGACCGAG
CCGGTGAGGAGGTGCTGCACGCATTCATACTGGTGCACAC
CAAACAGCTGGCCTTCTACTCCAGTCGTAATGCCAGCAAT
CTGAACCCTTCTGATCTCCTGGCTCTGATCATACTGGTGC
AAGATCTTTATCCCAGCAAAATAGACCTGGATGACACTCC
TGAGGAGCTGGAGAACAGTACAGTTCCTGATGTTTTTTAC
ACACCAGAGCCATCTCCTCCTGAACGAGAATCAGTCACAC
CAAGAAAGGACAGTCCTCCTGTCTTCCAGTTTGTGGATCC
TGATATTCAGATGGCTGAGGACAGTCTACAAACTCTTGAA
GTTTCAACCCCTGACCCTTCATCGCCGTCAAGAGTGTTTC
TGGAAGCCAAAGAGTGTCCCATGATGCCTCACTCCATGTA
TTGCCTGTCTCTATGGCCTGGTATCACACTAGTGCTGCTC
ACCAAGATCCCCAACAGTCATATGGCGGTGTCGGTTTACT
ACTTTCTGGAGGCTTTCGTCAAGCTGGAGAAGAGGTTAGG
TGAGGGCCATGAAGGGGCTTCAGCCATGCGGGGTCAGTCC
TCTGTCCAGGAGCAGCGGAGCAAACTGGAGAAGTTCATTA
AAGCCTGGTCCAGCATGGAGATTCAGACTTTGCAACTCCA
AAATGCTTGGACAGACTTTAAGAACAAGGCCTTCAGCAGA
TCTGGGACTGGATTTACTAGAGATTTGCTGCCGTCTTGTA
GAAACATGAAGACTCAGCTGTGTGGTGTGTACAGGCAGTT
TTTCGCAGCTGAATGTATGGGCAGCAGTCAGCGGTTGGCT
CCTCATCTGCAAGAACGGGCTCTGAACATGGTCCAAGAGA
AGCTGATGGACTGGAAGGATTTTCTTCTTGTTAAAAGCAA
AAGAAACATCACAATGGTGTCATACCTGGAGGAGTTTCCT
GGTCTCATCCACTTCATCTACGTGGATCGCTCAAGTGGTC
AAATGATCGCACCCTCTCTGAATGTGACTGATCGCACCGT
CTCTGAGCTCGGAAAGGGTCCTCTAGCTGACTTCATAAAG
AAAAAGGTTTGGAGTCTTGTAGCAACAGCACGACGGTATC
TGCACAAGGGTTATGCTACCGTCACACTTCGAGATGGGGA
TTACTTCTACTGTTACTTCCTGTGGTTTGAGAATGAAACG
GGCTACAAACTGGAAGTGACAGACATACCCAGTTGTCCAG
ATGACACCGCTCCAATAGGAATGCTCACATTTGATTATTA
TAGGAAACTGCTGCGGTACTACAGCAAAAAACATCAGAAT
GAAGTGGTGAAGTGTTATGAACTGCTGACTGTTCACCTGG
GCGTGATCCCTAATGAATATATTCTCCAGCACTGCAGCCA
ACTGGCCCGCAAGCTATGGGAGCCAACCCGCATCCCACTC
CTGTGACAATCCACATACACACTCCTCATATCAATTTATT
CTGTAGCTGCATGATCTGTAATCTAGATGAAGACTTTTCT
GCACTTTCTGCACAAGCACTTCCTTGTTTCAGTTCAGGTA
ACTCACTGTAGAAAACACTGGCGGGGAAACGAAACATCGC
GTTTCTTGCTCTTCATTAACAAACTAAATGTAATGTGCAA
ATGAACAGAGGAACAACTACTTTATGGTGCTCATAATGCA
AAAACATGTCTGTTATTTTTAACTGATGCTTTTTGTGATA
CCTGGACCAAATATTATAGTAAAGACCCTTTAAAATGCCA
TGAGAAGTCGCATAAGCTGAACTGCTAGTTCTTTAAGCAA
ATCATTTACATTATTAAACCAGTCATCAATGACTACAAAT
GTAGTAAATAAATGACTAAAAGGTGTAAAGGTTTACTCCA
AAATGAACATTTTGATGCTAATTTTCTCTGCCTCAGGCCA
TCCTAGATATGGCAGCTTTTTTTCTTCAGTGGACCACAGC
ATTTCACAAGACTAAATTAGAAATTTTAAATGACCAAAAA
ACATTGATAGGCCGACAGCAGGGTTGTCCAAAGTCGGTCC
TGGAGGGCCGGTGTCCTGCTGAGTTTAGCTCCAACTTGCT
TCAACACACCTGCACGGAAGTTTCTAGTATATCTAGTAAG
CTTGATTAGCTGGTTCAGGTGTGTTTTATTAGGGTTGGAG
CTAAACTCTCCAGGACACCGGCCCTCCTGGACCGAGTTTG
GACACCACTGGCCTACAGGCAAAGCATTGTCTCCGGTGAT
TTATTTGAGGTGATATGAAGTGAAGTGACCAATGCAGTAA
CATTGTTTGAATATTATTGACAACAAAAAAAAGAACTTTA
TTTACAACATTATTATTTTTTTAATCCACCGTCTAGTAAA
ATGGTCTTGAGCGATTCCCGGTTTGCGAATGGATATTTGA
ATGATTCTTTTTTGAGAACTAGTGAATCAGTTCACCAAAT
CAACTGAACTGTCTGAAACAGTTTGCGTGAGGTAGCACTT
TTAAAATTTCAGACAGTCATTCTTACTTGAAGTGAACCAA
TCTACTGTTTATCAATCATAAATCATAATTCCGAACGATA
TTAGGAATGTATGATGCCATGTTTGCAAACTTGTTCAATG
CTTCAGTTACTTGCATTGACTAAACTAAGCAAACGGTTCT
GAAGAAATTGCGAGCTGCAATGAAAGTTTTTATGATCTTT
AAATTTTTTATGTCAGTGAAGTTGTTAAAGACTGTATTTA
CTTTAAATGCTTTCGACATGTAAAGCTTCCCCATTTCATG
TGATATTGGTTGATTTGATCTTGAGCTCATGCCTTGTGAG
TCATCATCATTCAGTCATTTGAATCCGAAAAGATTCCATA
AGAAAAAAATACAATGTAGCAATTTATAGTAAACAGTGTT
TAAAGTGTGAACTATTCATTCGTTCATTTTCCTTCGGCTT
AATCCTTTTATTAATTTGGGGTCCCCAAGCATAGGTTTTA
CGCAGAAAGTGCCGTTCCAGCTGCTACCCATCACTGGGAA
ACACCCATACGCTCTCATTCACACACATTCACTATGGACA
ATTTAGCTTACTCAATTCACGTGTACCGCATGTCTTTGGA
CTTGTCAGGGAAAGCGGAGCACCCGGAGGAAACCCATGCG
AATGCGGGGAGAACATGCAAACTGGTTAAGCACTGGTTTA
AATGAGCTCAATATAATTAAAGTCTCACATTTTATTTGAT
TCGACTTAAAATTTAAATCAACTATCAATTTAGTTTTACT
ACAGTAAGCTGTGAAGAATTATAGAAGATGAAACTGTACA
TGCAGAAATTTTACCTCAAAATACCACAACAGATTAGTAC
TTTAGTATGCATGCTTTTTTTCCATATCGGGAAAAAGGGT
TTTAGTTGAAGATCTACTGAAAAGAAAAAAGTCCTATACA
ACTTGAATAGACCAAGGATGTGTAGAGTAACAGAAAATGT
TTATTTTGGGATGTGCTATCCCCTGTAAGTTATAACTGAA
AAATACAAATCTACATCTTAAAAGAAAAGTGTCAGTTTAT
TTGTCCAGCAGCCAAAAACATCCAATGTATCGCATAGCAG
AATTCATTTCTTGAAACACTTTTTTTTTTTTTTTTGTAGC
TGTAATTCTTGATCATGAATGTTGTTACACACATACAACA
AAACATTCCCCGAGTTAAAATTGTAGTTAAAGAAATCTAG
CGAAAGTGTTTTTTACTCTCTGATTTAGGTGTTAAAATAT
AAAAGTGATGTTTTTTTACATGACTGAATGTTTTTCTCTG
TACGCTGAAATCTCATTTATACTTTGCTTGAATAAATACA
GAATCTAAAACATTTTTTACACAATATGTAAAATATGTAT
TGGTGTTTGACGAGATAAATAAATATGAAATAATTTTCAG
AA

hps1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA hps1-002 (1) 827
mRNA hps1-201 4642
hps1-203 (1) 310
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hps1-201 Contained in:
[BAC] DKEYP-34H12 (1)
OTHER hps1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029726 (1)
  • Ensembl_Trans:ENSDART00000109822 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC108057 (1) 2370bp
    GenBank:CT684763 (1) 790bp
    GenBank:CT684764 (1) 779bp
    GenBank:CD583570 (1) 500bp
    GenBank:AL926541 (1) 461bp
    GenBank:EB941966 (1) 124bp
    CITATIONS (2)