Transcript

rfx2-202

ID
ZDB-TSCRIPT-090929-10971
Name
rfx2-202
Previous Names
  • rfx2-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000028480 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028480|OTTDARG00000022176|ZDB-GENE-050227-4 rfx2|OTTDARP00000023282 rfx2-004 LG_none CR450804.7,BX664738.14 Danio rerio protein_coding KNOWN, 639 bp
TATGGAAGCAGACACATTTAACAATCTTCTCCTTCTTTAC
CTTCTCCTAGTCTGTCTTTCAAAGGAGAAACGATGCAGCG
GTCAGAAGGGGGCTCAGAGACGCCATCCACCGTGGCGTTA
AGAACATCCACTTCAGCCCAGGCACCAGTGGTTCAGCCTG
TTCCCGCTTCGCAACAAGTACAGCAGGTTCAGCATTACCA
TTCCCAGCAGGTGCAATATGTGGAGGGTGCAGAGGCTGTC
TACCCCAATGGCACAATTCGTGCTGCATACTCTTATAACC
CAGAGTCCCAGCTATATGGTCAGGGCAGTGGAAGTGCCTA
TTTCGACTCTCAGGCGGGTGGTGCTCAGGTAACCACAGTC
GTCTCTTCTGGTGGAGTGCCCACTCATGGCATGGTGGGAA
TTGCTATGGATGTGGGTGGCAGTCAGATCATTTCCAGCGG
CAGCGCCTACCTGATCCACGGCGGGATGGAAGGTGGCCGC
CACCACACCTCTCACTCCTCACGCTCATCATCTGCAATGC
TTGAAATGGCGATTGAAAACCTCCAAAAGTCAGAAGGGAT
TGCCACTCACAAAAGCAGCCTGCTCAACAGCCATTTGCAG
TGGCTGCTGGATAATTATGAGACGGCTGAAGGTGTGAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations