ZFIN ID: ZDB-TSCRIPT-090929-10970
Transcript Name: rfx2-204
Previous Name: rfx2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028479 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028479|OTTDARG00000022176|ZDB-GENE-050227-4 rfx2|OTTDARP00000023281 rfx2-003 LG_none CR450804.7,BX664738.14 Danio rerio protein_coding KNOWN, 675 bp
GCCTCGAGACCCCCGCTCGCCATAGTGACTGTAGTCGTGG
AGACAGTTACTTACCAACGGGAGCAACACTCAGCAACAGC
AGCAGCAGCAGCAACTGGAGGAGAGAGAGAGGGAAAAGAA
CAGTAAAGCCAGGGCAGATCTAAGCACAAGGCTGAGGAGA
AACGATGCAGCGGTCAGAAGGGGGCTCAGAGACGCCATCC
ACCGTGGCGTTAAGAACATCCACTTCAGCCCAGGCACCAG
TGGTTCAGCCTGTTCCCGCTTCGCAACAAGTACAGCAGGT
TCAGCATTACCATTCCCAGCAGGTGCAATATGTGGAGGGT
GCAGAGGCTGTCTACCCCAATGGCACAATTCGTGCTGCAT
ACTCTTATAACCCAGAGTCCCAGCTATATGGTCAGGGCAG
TGGAAGTGCCTATTTCGACTCTCAGGCGGGTGGTGCTCAG
GTAACCACAGTCGTCTCTTCTGGTGGAGTGCCCACTCATG
GCATGGTGGGAATTGCTATGGATGTGGGTGGCAGTCAGAT
CATTTCCAGCGGCAGCGCCTACCTGATCCACGGCGGGATG
GAAGGTGGCCGCCACCACACCTCTCACTCCTCACGCTCAT
CATCTGCAATGCTTGAAATGGCGATTGAAAACCTCCAAAA
GTCAGAAGGGATTGCCACTCACAAAAGCAGCCTGC

rfx2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rfx2-201 (1)    Ensembl 3935
rfx2-202 (1)    Ensembl 639
rfx2-203 (1)    Ensembl 913
rfx2-204 675
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rfx2-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028479 (1),  Ensembl_Trans:ENSDART00000147634 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB931309 (1) 529 nt
GenBank:EB853003 (1) 486 nt
GenBank:EB933920 (1) 432 nt
GenBank:EB771355 (1) 427 nt
GenBank:EB929468 (1) 418 nt
GenBank:EB936756 (1) 417 nt
GenBank:EB775981 (1) 340 nt
CITATIONS (2)