Transcript

rfx2-203

ID
ZDB-TSCRIPT-090929-10969
Name
rfx2-203
Previous Names
  • rfx2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000028478 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028478|OTTDARG00000022176|ZDB-GENE-050227-4 rfx2|OTTDARP00000023280 rfx2-002 LG_none CR450804.7,BX664738.14 Danio rerio protein_coding KNOWN, 913 bp
CTCAGCAACAGCAGCAGCAGCAGCAACTGGAGGAGAGAGA
GAGGGAAAAGAACAGTAAAGCCAGGGCAGATCTAAGCACA
AGGCTGAGCTCCCGTTCAAGGATGTTACAGATGAGGCCTG
TCAAAGTGGGAGCGTGTTTGTCGCGCTGTGTGACGGGTCT
CTCAGCTGAAGGGGGTAAAACAGTGGAGCGACATGTCTGT
CAGGAGAAACGATGCAGCGGTCAGAAGGGGGCTCAGAGAC
GCCATCCACCGTGGCGTTAAGAACATCCACTTCAGCCCAG
GCACCAGTGGTTCAGCCTGTTCCCGCTTCGCAACAAGTAC
AGCAGGTTCAGCATTACCATTCCCAGCAGGTGCAATATGT
GGAGGGTGCAGAGGCTGTCTACCCCAATGGCACAATTCGT
GCTGCATACTCTTATAACCCAGAGTCCCAGCTATATGGTC
AGGGCAGTGGAAGTGCCTATTTCGACTCTCAGGCGGGTGG
TGCTCAGGTAACCACAGTCGTCTCTTCTGGTGGAGTGCCC
ACTCATGGCATGGTGGGAATTGCTATGGATGTGGGTGGCA
GTCAGATCATTTCCAGCGGCAGCGCCTACCTGATCCACGG
CGGGATGGAAGGTGGCCGCCACCACACCTCTCACTCCTCA
CGCTCATCATCTGCAATGCTTGAAATGGCGATTGAAAACC
TCCAAAAGTCAGAAGGGATTGCCACTCACAAAAGCAGCCT
GCTCAACAGCCATTTGCAGTGGCTGCTGGATAATTATGAG
ACGGCTGAAGGTGTGAGTCTGCCGCGGAGCTCTCTCTATA
ACCACTATCTGAGACACTGTCAGGAGCAAAAGCTGGATCC
AGTTAATGCAGCCTCTTTTGGCAAACTCATCCGCTCTGTC
TTCATGGGCCTTCGCACGCGCCGGCTTGGTACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations