header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1075
Transcript Name: st6galnac1.2-201
Previous Names: st6galnac1.2-001, si:ch211-51n14.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007886 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007886|OTTDARG00000007014|ZDB-GENE-041014-161 st6galnac1.2|OTTDARP00000006980 CH211-51N14.2-001 LG_ CR385044.5 Danio rerio protein_coding KNOWN, 1765 bp
ATGCAGCCAAGGCGAGGCGCACCTCAAACGAGCCTAAGGT
CTTTTCGTGTGAGTAGCAGTGTTTACGTGGTGGACGACTC
ACAATATTAGAGGAAAGAGCTGAAGTTGTGTAACGTTAAG
TATCAAACGCAAACGTACAATTACGTCTTGCACGTTATTG
TATTAGCGGGTTCATATGAGGGGGAGCAGCGTAATGGTTC
AAAAACGTCACCTAAAAGAGCTCTCTTGAGTCCTAATCAG
TTTGTGGACGCGCAGGTGCGCGTGTGCGTTGCCAGATCAT
GTTTCTCCTGAGGATTTTCTTAGTCACAACTTTCATAGCT
TCTCTTCCTTTGTTTATTTTTGTCACATTTTATAATGGAA
CTAGCACTTTACAGATAAAATGGAGACAGTATTACTATTG
GCTGAACCAAGGTCAAGTCGCAGGTTCTTTGCTGACAATT
GTGGAGCCTGAGCCAACCAACAGTTCAGCTTTAACTGACA
TATTAGCCAACACCACTACAATGAGGCTTGATCCTTTTGA
GACTCTATCAACTCCTCTGCCCATTATGGACAAACACAAA
TTCACTTCCTTGCCTCACTGGAAATTTGATGATCTGTATC
GATTGGACCCACATTTTAAACCGAGTGAATGTGCAACATC
CTTGCAAAATTCCTCAAATCCAACATTTAAGAAGAAGTTT
ATTCCAAACATACAGCTGTTTTTACAAAGTGATCATCTCA
ACATGAGTGAGTGGAATCGGCTCTATCACTTCAACAACCC
CTTTGGCTATATGGGACTTAATTACACAGCCATTAAAGCA
GCTGTTGAAACCATCCACAAACCTGCATCCAGCCAGTTGC
TGCAAGTACACCCAGGAGTGAAGGATGGCTGTATTCGTTG
TGCTGTTGTTGGGGCTTCTGGTATTCTCAATGGCTCCAAG
CTAGGAAAGGAAATTGACTCTAGCGATTATGTGTTTAGGA
TGAATGCAGCCATCATAGCAGGACATGAGGAGGATGTTGG
GAAAAGGACATCGGTTTATGTTCACACAGCACATTCCATA
ATCCAGTCCCTCATGATACACAAAAAAAGAGGATTCAAGC
AGATTCCTACTGACAAGGACATTAAATATGTTCTGATCCC
TGAGGGTCCTAGAGACTACAATTTTCTTGAGTCTCTTATG
AAGAACAGAAAAATACCATCAGGAGCATATCGAGGACGAA
CGCCAAGGAAATATTACAGCGGGCATTTTAATGAAAGTTC
CTACTACATCCTCCATCCAGATTTTCTCAGATATGTGCGA
AACAGATTTCTTAGGGCTAAACAACTAAAAACAAAGCGGT
GGTGGGTGGTCAGACCCACTAATGGAGCATTCACTCTTCT
GTTGGCTATGCACACCTGTGACATTGTTAGAGTCTATGGC
TTTTGCACGGCTGACTACCGGAAATATCCAAGCTACTATT
ATGACACCAAACACACTAAACTAGTGTTTTATGGTAATCA
TGATTATCGTTTGGAGATGAAAACCTGGAAGAAATTTCAT
GATGACAAATTAATCTGGATGTATTTGGGGAAATCTAATT
GAATGTTGGTGTCTTACAATACATTTGACTTTGCTGAAAT
AATCCAAATAATAAGAAAATGAATACAGCTAAGTCAGTTA
TTTCACAAAGACAAATGAGGTTGCAGTAAATTATAGTTGT
GTAGTGTTTCATAACTTTGCATTGTTAGGTTTTACTCTGT
TTTTTGGCATTTTGTAATAAAGAATTGATCAAATGAAAAG
AAAAA

st6galnac1.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA st6galnac1.2-201 1765
st6galnac1.2-203 (1)    Ensembl 942
st6galnac1.2-204 (1)    Ensembl 727
ncRNA st6galnac1.2-002 (1) 469
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
st6galnac1.2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000007886 (1),  Ensembl_Trans:ENSDART00000064335 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK708817 (1) 855 bp
GenBank:CK696704 (1) 828 bp
GenBank:BQ262608 (1) 677 bp
GenBank:BQ616022 (1) 673 bp
GenBank:BQ262688 (1) 638 bp
CITATIONS (2)