header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1076
Transcript Name: st6galnac1.2-002
Previous Name: si:ch211-51n14.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007887 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007887|OTTDARG00000007014|ZDB-GENE-041014-161 st6galnac1.2|no_translation CH211-51N14.2-002 LG_ CR385044.5 Danio rerio protein_coding KNOWN, 469 bp
GTGAGTAGCAGTGTTTACGTGGTGGACGACTCACAATATT
AGAGGAAAGAGCTGAAGTTGTGTAACGTTAAGTATCAAAC
GCAAACGTACAATTACGTCTTGCACGTTATTGTATTAGCG
GGTTCATATGAGGGGGAGCAGCGTAATGGTTCAAAAACGT
CACCTAAAAGAGCTCTCTTGAGTCCTAATCAGTTTGTGGA
CGCGCAGCACTTTACAGATAAAATGGAGACAGTATTACTA
TTGGCTGAACCAAGGTCAAGTCGCAGGTTCTTTGCTGACA
ATTGTGGAGCCTGAGCCAACCAACAGTTCAGCTTTAACTG
ACATATTAGCCAACACCACTACAATGAGGCTTGATCCTTT
TGAGACTCTATCAACTCCTCTGCCCATTATGGACAAACAC
AAATTCACTTCCTTGCCTCACTGGAAATTTGATGATCTGT
ATCGATTGGACCCACATTTTAAACCGAGT

st6galnac1.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA st6galnac1.2-201 (1)    Ensembl 1765
st6galnac1.2-203 (1)    Ensembl 942
st6galnac1.2-204 (1)    Ensembl 727
ncRNA st6galnac1.2-002 469
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
st6galnac1.2-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000007887 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CB363166 (1) 477 bp
CITATIONS (1)