header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-61
Transcript Name: st6galnac1.2-204
Previous Names: ch211-51n14.2-005, st6galnac1.2-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058356 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058356|OTTDARG00000007014|ZDB-GENE-041014-161 st6galnac1.2|OTTDARP00000045623 CH211-51N14.2-005 LG_ CR385044.5 Danio rerio protein_coding KNOWN, 727 bp
AGCTAGGAAAGGAAATTGACTCTAGCGATTATGTGTTTAG
GATGAATGCAGCCATCATAGCAGGACATGAGGAGGATGTT
GGGAAAAGGACATCGGTTTATGTTCACACAGCACATTCCA
TAATCCAGTCCCTCATGATACACAAAAAAAGAGGATTCAA
GCAGATTCCTACTGACAAGGACATTAAATATGTTCTGATC
CCTGAGGGTCCTAGAGACTACAATTTTCTTGAGTCTCTTA
TGAAGAACAGAAAAATACCATCAGGAGCATATCGAGGACG
AACGCCAAGGAAATATTACAGCGGGCATTTTAATGAAAGT
TCCTACTACATCCTCCATCCAGATTTTCTCAGATATGTGC
GAAACAGATTTCTTAGGGCTAAACAACTAAAAACAAAGCG
GTGGTGGGTGGTCAGACCCACTAATGGAGCATTCACTCTT
CTGTTGGCTATGCACACCTGTGACATTGTTAGAGTCTATG
GCTTTTGCACGGCTGACTACCGGAAATATCCAAGCTACTA
TTATGACACCAAACACACTAAACTAGTGTTTTATGGTTTC
CATGTGATGTTTCTGGCGTTCAGGATGGCTTACATACGGT
GTACACGTGCTGCTCAAAAACAGACATTCACTTTATGTAT
CATAGGACCGCAAAACAAATTGAAACCTTATGTGCTGAAT
ATCTAACCATATTTTTGTAATAATAATATAAATAAATAAG
TTAAACC

st6galnac1.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA st6galnac1.2-201 (1)    Ensembl 1765
st6galnac1.2-203 (1)    Ensembl 942
st6galnac1.2-204 727
ncRNA st6galnac1.2-002 (1) 469
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
st6galnac1.2-204 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058356 (1),  Ensembl_Trans:ENSDART00000153370 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH560685 (1) 728 bp
CITATIONS (2)