Morpholino

MO1-bcl11ba

ID

ZDB-MRPHLNO-190711-5

Name

MO1-bcl11ba

Previous Names

None

Target

bcl11ba (1)

Sequence

5' - TTCCCTGCTTGCGACGGGACATTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bcl11ba

Expressed Gene	Anatomy	Figures
ccr9b	whole organism	Fig. 4 from Punwani et al., 2016
lck	(not) T cell	Fig. 3 from Punwani et al., 2016
myb	hematopoietic cell	Fig. 4 from Punwani et al., 2016

Phenotype

Phenotype resulting from MO1-bcl11ba

Phenotype	Fish	Figures
embryonic viscerocranium morphogenesis process quality, abnormal	WT + MO1-bcl11ba	Fig. 2, Fig. 3 from Punwani et al., 2016
eye increased distance eye, abnormal	WT + MO1-bcl11ba	Fig. 2 from Punwani et al., 2016
hematopoietic cell myb expression increased distribution, abnormal	WT + MO1-bcl11ba	Fig. 4 from Punwani et al., 2016
hematopoietic stem cell migration decreased occurrence, abnormal	WT + MO1-bcl11ba	Fig. 4 from Punwani et al., 2016
lymphoid lineage cell migration into thymus decreased occurrence, abnormal	la2Tg + MO1-bcl11ba	Fig. 4 from Punwani et al., 2016
splanchnocranium malformed, abnormal	WT + MO1-bcl11ba	Fig. 2, Fig. 3 from Punwani et al., 2016
T cell absent, abnormal	cz2Tg + MO1-bcl11ba	Figure 1 from Lu et al., 2021 Fig. 2, Fig. 3 from Punwani et al., 2016
T cell EGFP expression absent, abnormal	cz2Tg + MO1-bcl11ba	Fig. 2 from Punwani et al., 2016
T cell lck expression absent, abnormal	WT + MO1-bcl11ba	Fig. 3 from Punwani et al., 2016
T cell differentiation disrupted, abnormal	WT + MO1-bcl11ba	Figure 1 from Lu et al., 2021
thymus thrombocyte EGFP expression absent, abnormal	la2Tg + MO1-bcl11ba	Fig. 4 from Punwani et al., 2016
whole organism ccr9b expression increased amount, abnormal	WT + MO1-bcl11ba	Fig. 4 from Punwani et al., 2016

Phenotype of all Fish created by or utilizing MO1-bcl11ba

Phenotype	Fish	Conditions	Figures
hematopoietic stem cell migration decreased occurrence, abnormal	WT + MO1-bcl11ba	standard conditions	Fig. 4 from Punwani et al., 2016
T cell differentiation disrupted, abnormal	WT + MO1-bcl11ba	standard conditions	Figure 1 from Lu et al., 2021
hematopoietic cell myb expression increased distribution, abnormal	WT + MO1-bcl11ba	standard conditions	Fig. 4 from Punwani et al., 2016
whole organism ccr9b expression increased amount, abnormal	WT + MO1-bcl11ba	standard conditions	Fig. 4 from Punwani et al., 2016
T cell lck expression absent, abnormal	WT + MO1-bcl11ba	standard conditions	Fig. 3 from Punwani et al., 2016
embryonic viscerocranium morphogenesis process quality, abnormal	WT + MO1-bcl11ba	control	Fig. 2, Fig. 3 from Punwani et al., 2016
splanchnocranium malformed, abnormal	WT + MO1-bcl11ba	control	Fig. 2, Fig. 3 from Punwani et al., 2016
eye increased distance eye, abnormal	WT + MO1-bcl11ba	standard conditions	Fig. 2 from Punwani et al., 2016
T cell absent, abnormal	WT + MO1-bcl11ba	control	Figure 1 from Lu et al., 2021 Fig. 3 from Punwani et al., 2016
T cell EGFP expression absent, abnormal	cz2Tg + MO1-bcl11ba	standard conditions	Fig. 2 from Punwani et al., 2016
T cell absent, abnormal	cz2Tg + MO1-bcl11ba	standard conditions	Fig. 2 from Punwani et al., 2016
lymphoid lineage cell migration into thymus decreased occurrence, abnormal	la2Tg + MO1-bcl11ba	standard conditions	Fig. 4 from Punwani et al., 2016
thymus thrombocyte EGFP expression absent, abnormal	la2Tg + MO1-bcl11ba	standard conditions	Fig. 4 from Punwani et al., 2016
lymphoid lineage cell migration into thymus occurrence, ameliorated	la2Tg + MO1-bcl11ba + MO1-ccr9b	standard conditions	Fig. 4 from Punwani et al., 2016
thymus thrombocyte EGFP expression amount, ameliorated	la2Tg + MO1-bcl11ba + MO1-ccr9b	standard conditions	Fig. 4 from Punwani et al., 2016

Citations