ZFIN ID: ZDB-MRPHLNO-160728-3
Morpholino Name: MO1-trim69
Target: trim69 (1)
Previous Name: trim69-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGTTGGCAGGAGTTTCACGCATGAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-trim69 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-trim69
Expressed Gene Anatomy Figures
ascl1a Fig. 3 with image from Han et al., 2016
baxa Fig. 11 from Han et al., 2016
casp3a Fig. 11 from Han et al., 2016
cdkn1a Fig. 11 from Han et al., 2016
egr2b Fig. S4 with image from Han et al., 2016
en2a Fig. S4 with image from Han et al., 2016
fgf8a Fig. S4 with image from Han et al., 2016
gfap Fig. 3 with image from Han et al., 2016
mdm2 Fig. 11 from Han et al., 2016
nanog Fig. 3 with image from Han et al., 2016
otx2b Fig. S4 with image from Han et al., 2016
pax2a Fig. 3 with image from Han et al., 2016
pax3a Fig. 3 with image from Han et al., 2016
pax6a Fig. 3 with image from Han et al., 2016
pax7a Fig. 3 with image from Han et al., 2016
sox2 Fig. 3 with image from Han et al., 2016
tp53 Fig. 11 from Han et al., 2016
wnt1 Fig. 3 with image from Han et al., 2016
PHENOTYPE
Phenotype resulting from MO1-trim69
Phenotype Figures
apoptotic process increased occurrence, abnormal Fig. 6 from Han et al., 2016
brain apoptotic, abnormal Fig. 2 with imageFig. 7 with image from Han et al., 2016
brain gfap expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain ascl1a expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain pax2a expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain pax7a expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain wnt1 expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain pax6a expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain sox2 expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain pax3a expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain nanog expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
brain deformed, abnormal Fig. 7 with image from Han et al., 2016
brain development disrupted, abnormal Fig. 2 with imageFig. 7 with image from Han et al., 2016
forebrain fgf8a expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
forebrain otx2b expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
hindbrain en2a expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
hindbrain egr2b expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
midbrain hindbrain boundary absent, abnormal Fig. 2 with imageFig. 7 with image from Han et al., 2016
midbrain hindbrain boundary en2a expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
midbrain hindbrain boundary otx2b expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
midbrain hindbrain boundary egr2b expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
midbrain hindbrain boundary fgf8a expression decreased amount, abnormal Fig. S4 with image from Han et al., 2016
neuronal stem cell sox2 expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
neuronal stem cell nanog expression decreased amount, abnormal Fig. 3 with image from Han et al., 2016
whole organism casp3a expression increased amount, abnormal Fig. 11 from Han et al., 2016
whole organism baxa expression increased amount, abnormal Fig. 11 from Han et al., 2016
whole organism mdm2 expression increased amount, abnormal Fig. 11 from Han et al., 2016
whole organism tp53 expression increased amount, abnormal Fig. 11 from Han et al., 2016
whole organism cdkn1a expression increased amount, abnormal Fig. 11 from Han et al., 2016

Phenotype of all Fish created by or utilizing MO1-trim69
Phenotype Fish Conditions Figures
brain deformed, abnormal WT + MO1-trim69 standard conditions Fig. 7 with image from Han et al., 2016
forebrain fgf8a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
midbrain hindbrain boundary absent, abnormal WT + MO1-trim69 standard conditions Fig. 2 with imageFig. 7 with image from Han et al., 2016
hindbrain en2a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
brain gfap expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
brain wnt1 expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
apoptotic process increased occurrence, abnormal WT + MO1-trim69 standard conditions Fig. 6 from Han et al., 2016
brain nanog expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
forebrain otx2b expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
midbrain hindbrain boundary en2a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
whole organism tp53 expression increased amount, abnormal WT + MO1-trim69 standard conditions Fig. 11 from Han et al., 2016
midbrain hindbrain boundary fgf8a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
brain pax7a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
neuronal stem cell sox2 expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
brain pax3a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
brain apoptotic, abnormal WT + MO1-trim69 standard conditions Fig. 2 with imageFig. 7 with image from Han et al., 2016
whole organism cdkn1a expression increased amount, abnormal WT + MO1-trim69 standard conditions Fig. 11 from Han et al., 2016
midbrain hindbrain boundary otx2b expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
brain pax6a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
brain sox2 expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
whole organism casp3a expression increased amount, abnormal WT + MO1-trim69 standard conditions Fig. 11 from Han et al., 2016
neuronal stem cell nanog expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
brain pax2a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
brain ascl1a expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. 3 with image from Han et al., 2016
brain development disrupted, abnormal WT + MO1-trim69 standard conditions Fig. 2 with imageFig. 7 with image from Han et al., 2016
hindbrain egr2b expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
whole organism mdm2 expression increased amount, abnormal WT + MO1-trim69 standard conditions Fig. 11 from Han et al., 2016
whole organism baxa expression increased amount, abnormal WT + MO1-trim69 standard conditions Fig. 11 from Han et al., 2016
midbrain hindbrain boundary egr2b expression decreased amount, abnormal WT + MO1-trim69 standard conditions Fig. S4 with image from Han et al., 2016
apoptotic process increased occurrence, abnormal WT + MO1-trim69 + MO4-tp53 standard conditions Fig. 6 from Han et al., 2016
brain sox2 expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
brain ascl1a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
midbrain hindbrain boundary morphology, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain development process quality, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain morphology, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain pax7a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
brain pax3a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
apoptotic process process quality, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain nanog expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
brain pax6a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
Genome Resources:
CITATIONS (2)