ZFIN ID: ZDB-MRPHLNO-160119-5
Morpholino Name: MO4-numb
Target: numb (1)
Sequence:
5' - AACTCTGCCGTAGCTTATTCATCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-numb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-numb
Expressed Gene Anatomy Figures
gcga Fig. 5 with image from Won et al., 2015
ins Fig. 5 with image from Won et al., 2015
numb Fig. 6 with image from Won et al., 2015
prss1 Fig. 5 with image from Won et al., 2015
ptf1a Fig. 5 with image from Won et al., 2015
PHENOTYPE
Phenotype resulting from MO4-numb
No data available

Phenotype of all Fish created by or utilizing MO4-numb
Phenotype Fish Conditions Figures
exocrine pancreas development process quality, ameliorated lnx2ay447/y447 + MO4-numb control Fig. 5 with imageFig. S5 with image from Won et al., 2015
exocrine pancreas prss1 expression amount, ameliorated lnx2ay447/y447 + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression spatial pattern, ameliorated lnx2ay447/y447 + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression amount, ameliorated lnx2ay447/y447 + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression spatial pattern, ameliorated lnx2ay447/y447 + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas development process quality, ameliorated AB + MO1-lnx2a + MO4-numb standard conditions Fig. 5 with imageFig. S5 with image from Won et al., 2015
exocrine pancreas ptf1a expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
pancreas Venus expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas numb expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas mCherry expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
Genome Resources:
CITATIONS (1)