ZFIN ID: ZDB-MRPHLNO-151216-8
Morpholino Name: MO3-rbfox1
Target: rbfox1 (1)
Sequence:
5' - CCACCATCTTGCTCCCTTTTTCCTCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-rbfox1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-rbfox1 No data available
PHENOTYPE
Phenotype resulting from MO3-rbfox1
Phenotype Figures
atrium dilated, abnormal Fig. 3 with image from Frese et al., 2015
blood circulation arrested, abnormal Fig. 2 with image from Frese et al., 2015
brain edematous, abnormal Fig. 2 with image from Frese et al., 2015
cardiac ventricle collapsed, abnormal Fig. 2 with image from Frese et al., 2015
cardiac ventricle decreased contractility, abnormal Fig. 2 with image from Frese et al., 2015
heart decreased functionality, abnormal Fig. 2 with image from Frese et al., 2015
heart alternative mRNA splicing, via spliceosome process quality, abnormal Fig. 5 from Frese et al., 2015
regulation of RNA splicing disrupted, abnormal Fig. 5 from Frese et al., 2015

Phenotype of all Fish created by or utilizing MO3-rbfox1
Phenotype Fish Conditions Figures
heart alternative mRNA splicing, via spliceosome process quality, abnormal WT + MO3-rbfox1 standard conditions Fig. 5 from Frese et al., 2015
regulation of RNA splicing disrupted, abnormal WT + MO3-rbfox1 standard conditions Fig. 5 from Frese et al., 2015
cardiac ventricle decreased contractility, abnormal WT + MO3-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
heart decreased functionality, abnormal WT + MO3-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
atrium dilated, abnormal WT + MO3-rbfox1 standard conditions Fig. 3 with image from Frese et al., 2015
blood circulation arrested, abnormal WT + MO3-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
cardiac ventricle collapsed, abnormal WT + MO3-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
brain edematous, abnormal WT + MO3-rbfox1 standard conditions Fig. 2 with image from Frese et al., 2015
OTHER MO3-rbfox1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)