header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150224-1
Morpholino Name: MO1-pappa2
Target: pappa2 (1)
Previous Name: e1i1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAATTTACAGACACACCCACCTGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pappa2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pappa2 No data available
PHENOTYPE
Phenotype resulting from MO1-pappa2
Phenotype Figures
angiogenesis disrupted, abnormal Fig. 6 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage absent, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage decreased size, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel branched, abnormal Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel decreased size, abnormal Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel extends beyond somite, abnormal Fig. 6 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal Fig. 7 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal Fig. 3 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal Fig. 4 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal Fig. 6 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal Fig. 3 with image from Kjaer-Sorensen et al., 2014

Phenotype of all Fish created by or utilizing MO1-pappa2
Phenotype Fish Conditions Figures
ceratohyal cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
hyosymplectic cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
trunk curved ventral, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
notochord undulate, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 3 with image from Kjaer-Sorensen et al., 2014
neurocranial trabecula absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
pharyngeal arch 3-7 decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
palatoquadrate arch absent, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ceratohyal cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
ethmoid cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
cranial neural crest cell decreased amount, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO1-pappa2 + MO4-tp53 standard conditions Fig. 4 with image from Kjaer-Sorensen et al., 2014
regulation of Notch signaling pathway disrupted, abnormal um13Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
Notch signaling pathway disrupted, abnormal um13Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 7 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel extends beyond somite, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel decreased size, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
intersegmental vessel branched, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
angiogenesis disrupted, abnormal y1Tg + MO1-pappa2 + MO4-tp53 standard conditions Fig. 6 with image from Kjaer-Sorensen et al., 2014
OTHER MO1-pappa2 MORPHOLINO PAGES No links to external sites
CITATIONS (1)