ZFIN ID: ZDB-MRPHLNO-140513-2
Morpholino Name: MO2-sfrp5
Target: sfrp5 (1)
Previous Name: sfrp5-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGAGTGCTGTAGATAGAACAAAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sfrp5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sfrp5 No data available
PHENOTYPE
Phenotype resulting from MO2-sfrp5
No data available

Phenotype of all Fish created by or utilizing MO2-sfrp5
Phenotype Fish Conditions Figures
camera-type eye morphogenesis process quality, abnormal WT + MO2-sfrp5 + MO3-sfrp1a standard conditions Fig. 3 with image from Holly et al., 2014
eye decreased size, abnormal WT + MO2-sfrp5 + MO3-sfrp1a standard conditions Fig. 3 with image from Holly et al., 2014
closure of optic fissure arrested, abnormal WT + MO2-sfrp5 + MO3-sfrp1a standard conditions Fig. 3 with image from Holly et al., 2014
BMP signaling pathway increased process quality, abnormal mw29Tg + MO2-sfrp5 + MO3-sfrp1a standard conditions Fig. 6 with image from Holly et al., 2014
Wnt signaling pathway decreased process quality, abnormal w25Tg + MO2-sfrp5 + MO3-sfrp1a standard conditions Fig. 4 with image from Holly et al., 2014
OTHER MO2-sfrp5 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)