Morpholino

MO1-hace1

ID

ZDB-MRPHLNO-130913-1

Name

MO1-hace1

Previous Names

hace1-HECT (1)

Target

hace1 (1)

Sequence

5' - CCCTCGAACTGTTAGACAGAATAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hace1

Expressed Gene	Anatomy	Figures
bmp4	heart	Fig. 3 from Razaghi et al., 2017
rac1a	heart	Fig. 5 from Razaghi et al., 2017

Phenotype

Phenotype resulting from MO1-hace1

Phenotype	Fish	Figures
atrioventricular canal morphology, abnormal	AB + MO1-hace1	Fig. 3 from Razaghi et al., 2017
cardiac ventricle decreased thickness, abnormal	AB + MO1-hace1	Fig. 3 from Razaghi et al., 2017
cardiac ventricle elongated, abnormal	AB + MO1-hace1	Fig. 3 from Razaghi et al., 2017
heart bmp4 expression decreased amount, abnormal	AB + MO1-hace1	Fig. 3 from Razaghi et al., 2017
heart inverted, abnormal	twu34Tg + MO1-hace1	Fig. 2 from Razaghi et al., 2017
heart morphology, abnormal	twu34Tg + MO1-hace1	Fig. 2 from Razaghi et al., 2017
heart tubular, abnormal	twu34Tg + MO1-hace1	Fig. 1 from Razaghi et al., 2017
heart contraction decreased rate, abnormal	twu34Tg + MO1-hace1	Fig. 2 from Razaghi et al., 2017
heart looping disrupted, abnormal	twu34Tg + MO1-hace1	Fig. 1 from Razaghi et al., 2017
whole organism reactive oxygen species increased amount, abnormal	AB + MO1-hace1	Fig. 4 from Razaghi et al., 2017

Phenotype of all Fish created by or utilizing MO1-hace1

Phenotype	Fish	Conditions	Figures
cardiac ventricle elongated, abnormal	AB + MO1-hace1	standard conditions	Fig. 3 from Razaghi et al., 2017
whole organism reactive oxygen species increased amount, abnormal	AB + MO1-hace1	standard conditions	Fig. 4 from Razaghi et al., 2017
heart tubular, abnormal	AB + MO1-hace1	standard conditions	Fig. 1 from Razaghi et al., 2017
atrioventricular canal morphology, abnormal	AB + MO1-hace1	standard conditions	Fig. 3 from Razaghi et al., 2017
heart looping disrupted, abnormal	AB + MO1-hace1	standard conditions	Fig. 1 from Razaghi et al., 2017
heart bmp4 expression decreased amount, abnormal	AB + MO1-hace1	standard conditions	Fig. 3 from Razaghi et al., 2017
cardiac ventricle decreased thickness, abnormal	AB + MO1-hace1	standard conditions	Fig. 3 from Razaghi et al., 2017
heart inverted, abnormal	twu34Tg + MO1-hace1	standard conditions	Fig. 2 from Razaghi et al., 2017
heart tubular, abnormal	twu34Tg + MO1-hace1	standard conditions	Fig. 1 from Razaghi et al., 2017
heart morphology, abnormal	twu34Tg + MO1-hace1	standard conditions	Fig. 2 from Razaghi et al., 2017
heart looping disrupted, abnormal	twu34Tg + MO1-hace1	standard conditions	Fig. 1 from Razaghi et al., 2017
heart contraction decreased rate, abnormal	twu34Tg + MO1-hace1	standard conditions	Fig. 2 from Razaghi et al., 2017
heart reactive oxygen species increased amount, abnormal	sd21Tg + MO1-hace1	standard conditions	Fig. 4 , Fig. 6 from Razaghi et al., 2017
heart looping disrupted, abnormal	sd21Tg + MO1-hace1	standard conditions	Fig. 4 , Fig. 6 from Razaghi et al., 2017
whole organism reactive oxygen species amount, ameliorated	sd21Tg + MO1-hace1 + MO1-nox1 + MO2-cybb	standard conditions	Fig. 6 from Razaghi et al., 2017
heart looping process quality, ameliorated	sd21Tg + MO1-hace1 + MO1-nox1 + MO2-cybb	standard conditions	Fig. 6 from Razaghi et al., 2017
regulation of reactive oxygen species metabolic process disrupted, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO1-hace1	standard conditions	Fig. 1 from Daugaard et al., 2013
heart rac1a expression decreased amount, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO1-hace1	standard conditions	Fig. 5 from Razaghi et al., 2017
signal transduction in response to DNA damage increased occurrence, abnormal	mitfa^w2/w2; mpv17^a9/a9 + MO1-hace1	standard conditions	Fig. 4 from Daugaard et al., 2013

Citations