header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130910-6
Morpholino Name: MO4-mtm1
Target: mtm1 (1)
Previous Name: translational MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCCAGACCCTCGTCGAAAAGTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-mtm1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-mtm1 No data available
PHENOTYPE
Phenotype resulting from MO4-mtm1
Phenotype of all Fish created by or utilizing MO4-mtm1
Phenotype Fish Conditions Figures
locomotory behavior disrupted, abnormal AB + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule absent, abnormal AB + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO4-mtm1 standard conditions Fig. 4 with imageFig. 7 with image from Gupta et al., 2013
whole organism decreased mobility, abnormal AB + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
skeletal muscle refractivity, abnormal AB + MO4-mtm1 standard conditions Fig. 2 with imageFig. 7 with image from Gupta et al., 2013
hatching decreased occurrence, abnormal AB + MO4-mtm1 standard conditions text only from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
trunk curved dorsal, abnormal AB + MO4-mtm1 standard conditions Fig. 2 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
muscle morphology, abnormal WT + MO4-mtm1 standard conditions Fig. 3 from Smith et al., 2013
skeletal muscle refractivity, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with imageFig. 7 with image from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle non-functional, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle Z disc absent, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
thigmotaxis disrupted, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
whole organism decreased size, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with image from Gupta et al., 2013
OTHER MO4-mtm1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)