Morpholino

MO1-atg5

ID
ZDB-MRPHLNO-121010-2
Name
MO1-atg5
Previous Names
  • 5MOatg5 (1)
Target
Sequence
5' - CATCCTTGTCATCTGCCATTATCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atg5
No data available
Phenotype
Phenotype resulting from MO1-atg5
Phenotype Fish Figures
blood decreased volume, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
diencephalon dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 Fig. 5Fig. 6 from Hu et al., 2017
dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 Fig. 4 from Hu et al., 2017
embryo development disrupted, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
extension decreased length, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
eye decreased size, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
eye development disrupted, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
head decreased size, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
heart structure, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
post-vent region decreased length, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
somite structure, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
swimming decreased process quality, abnormal AB + MO1-atg5 Fig. 7 from Hu et al., 2017
trunk decreased length, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
whole organism dead, abnormal WT + MO1-atg5 Fig. 2 from Mans et al., 2017
whole organism ab1-atg5 labeling decreased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab3-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 Figure 5 with image from Inoue et al., 2021
whole organism ab2-map1lc3 labeling decreased amount, abnormal WT + MO1-atg5 Fig. 2 with image from Giong et al., 2024
whole organism Ab5-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab3-th labeling decreased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism atg5 expression decreased amount, abnormal WT + MO1-atg5 Fig. 2 with image from Giong et al., 2024
whole organism decreased life span, abnormal WT + MO1-atg5 Fig. 2 from Mans et al., 2017
whole organism Ab1-park8 labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab4-sqstm1 labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism Ab2-pink1 labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism ab2-sncb labeling increased amount, abnormal AB + MO1-atg5 Fig. 3 from Hu et al., 2017
whole organism morphology, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
whole organism viability, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal TU + MO1-atg5 Fig. 3 from Hu et al., 2011
Phenotype of all Fish created by or utilizing MO1-atg5
Phenotype Fish Conditions Figures
diencephalon dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 control Fig. 5Fig. 6 from Hu et al., 2017
whole organism ab3-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 control Figure 5 with image from Inoue et al., 2021
dopaminergic neuron decreased amount, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 4 from Hu et al., 2017
swimming decreased process quality, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 7 from Hu et al., 2017
whole organism ab1-atg5 labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab1-park8 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
swimming decreased process quality, abnormal AB + MO1-atg5 control Fig. 7 from Hu et al., 2017
whole organism ab3-th labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab5-map1lc3b labeling decreased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
dopaminergic neuron decreased amount, abnormal AB + MO1-atg5 control Fig. 4 from Hu et al., 2017
diencephalon dopaminergic neuron decreased amount, exacerbated AB + MO1-atg5 chemical treatment by environment: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine Fig. 5Fig. 6 from Hu et al., 2017
whole organism ab2-sncb labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism Ab2-pink1 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism ab4-sqstm1 labeling increased amount, abnormal AB + MO1-atg5 control Fig. 3 from Hu et al., 2017
whole organism decreased life span, exacerbated AB/TL + MO1-atg5 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 5 with image from Masud et al., 2019
post-vent region decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
extension decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye decreased size, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
trunk decreased length, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
heart structure, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye development disrupted, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
somite structure, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
blood decreased volume, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
whole organism viability, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
whole organism morphology, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
head decreased size, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
embryo development disrupted, abnormal TU + MO1-atg5 standard conditions Fig. 3 from Hu et al., 2011
lateral rectus regenerating tissue decreased length, abnormal WT + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
whole organism ab2-map1lc3 labeling decreased amount, abnormal WT + MO1-atg5 standard conditions Fig. 2 with image from Giong et al., 2024
lateral rectus skeletal muscle tissue regeneration decreased process quality, abnormal WT + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
whole organism dead, abnormal WT + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
whole organism atg5 expression decreased amount, abnormal WT + MO1-atg5 standard conditions Fig. 2 with image from Giong et al., 2024
whole organism decreased life span, abnormal WT + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
primary motor neuron axon decreased length, abnormal krb5Tg/krb5Tg + MO1-atg5 standard conditions Fig. 2 with image from Giong et al., 2024
whole organism ab2-map1lc3 labeling decreased amount, abnormal krb5Tg/krb5Tg + MO1-atg5 standard conditions Fig. 2 with image from Giong et al., 2024
primary motor neuron axon decreased branchiness, abnormal krb5Tg/krb5Tg + MO1-atg5 standard conditions Fig. 2 with image from Giong et al., 2024
whole organism atg5 expression decreased amount, abnormal krb5Tg/krb5Tg + MO1-atg5 standard conditions Fig. 2 with image from Giong et al., 2024
swim bladder inflated, ameliorated lars1boi3/oi3 + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
pericardium morphology, ameliorated lars1boi3/oi3 + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
intestine cell hypotrophic, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
whole organism dead, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
intestine edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
heart edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
intestinal epithelium cell detached from intestine, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. 6 with image from Boglev et al., 2013
eye edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
head edematous, abnormal pwp2hs450/s450 + MO1-atg5 standard conditions Fig. S7 with image from Boglev et al., 2013
whole organism decreased life span, abnormal stk11hu1968/hu1968 + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
whole organism dead, abnormal stk11hu1968/hu1968 + MO1-atg5 standard conditions Fig. 2 from Mans et al., 2017
lateral rectus regenerating tissue EGFP expression decreased amount, abnormal zf155Tg + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
autophagy disrupted, abnormal zf155Tg + MO1-atg5 resection: lateral rectus Fig. 3 with image from Saera-Vila et al., 2016
liver size, ameliorated lars1boi3/oi3; oi2Tg + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
Citations