ZFIN ID: ZDB-MRPHLNO-120813-4
Morpholino Name: MO1-tbl3
Target: tbl3 (1)
Sequence:
5' - TGAAGAGCAGCGTTTTCCCAGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tbl3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tbl3
Expressed Gene Anatomy Figures
fabp2 Fig. 3 with image from Hutchinson et al., 2012
lck Fig. 3 with image from Hutchinson et al., 2012
myb Fig. 3 with image from Hutchinson et al., 2012
prss1 Fig. 3 with image from Hutchinson et al., 2012
vsx2 Fig. 5 with image from Hutchinson et al., 2012
PHENOTYPE
Phenotype resulting from MO1-tbl3
Phenotype of all Fish created by or utilizing MO1-tbl3
Phenotype Fish Conditions Figures
retina morphogenesis in camera-type eye delayed, abnormal WT + MO1-tbl3 standard conditions Fig. 6 with image from Hutchinson et al., 2012
exocrine pancreas hypoplastic, abnormal WT + MO1-tbl3 standard conditions Fig. 3 with image from Hutchinson et al., 2012
M phase increased duration, abnormal WT + MO1-tbl3 standard conditions Fig. 6 with image from Hutchinson et al., 2012
S phase increased duration, abnormal WT + MO1-tbl3 standard conditions Fig. 6 with image from Hutchinson et al., 2012
cell population proliferation increased occurrence, abnormal WT + MO1-tbl3 standard conditions Fig. 6 with image from Hutchinson et al., 2012
hematopoietic stem cell decreased amount, abnormal WT + MO1-tbl3 standard conditions Fig. 3 with image from Hutchinson et al., 2012
intestine hypoplastic, abnormal WT + MO1-tbl3 standard conditions Fig. 3 with image from Hutchinson et al., 2012
T cell absent, abnormal cz1Tg + MO1-tbl3 standard conditions Fig. 3 with image from Hutchinson et al., 2012
blood island has fewer parts of type hematopoietic stem cell, abnormal la2Tg + MO1-tbl3 standard conditions Fig. 4 with image from Hutchinson et al., 2012
hematopoietic stem cell proliferation decreased rate, abnormal la2Tg + MO1-tbl3 standard conditions Fig. 4 with image from Hutchinson et al., 2012
intestine hypoplastic, abnormal tp53zy7/zy7 + MO1-tbl3 standard conditions Fig. 3 with image from Hutchinson et al., 2012
hematopoietic stem cell decreased amount, abnormal tp53zy7/zy7 + MO1-tbl3 standard conditions Fig. 3 with image from Hutchinson et al., 2012
exocrine pancreas hypoplastic, abnormal tp53zy7/zy7 + MO1-tbl3 standard conditions Fig. 3 with image from Hutchinson et al., 2012
Genome Resources:
CITATIONS (1)