ZFIN ID: ZDB-MRPHLNO-110725-3
Morpholino Name: MO3-rp2
Target: rp2 (1)
Previous Name: AUG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGCCTGTCAGCATAAAGTCTTTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-rp2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-rp2 No data available
PHENOTYPE
Phenotype resulting from MO3-rp2
Phenotype Figures
eye decreased size, abnormal Fig. 2 with image from Patil et al., 2011
photoreceptor cell development disrupted, abnormal Fig. 2 with imageFig. S1 with image from Patil et al., 2011
photoreceptor cell morphogenesis disrupted, abnormal Fig. 2 with imageFig. S1 with image from Patil et al., 2011
photoreceptor cell outer segment organization disrupted, abnormal Fig. 2 with imageFig. S1 with image from Patil et al., 2011
retinal cone cell development disrupted, abnormal Fig. 2 with image from Patil et al., 2011

Phenotype of all Fish created by or utilizing MO3-rp2
Phenotype Fish Conditions Figures
photoreceptor cell outer segment organization disrupted, abnormal WT + MO3-rp2 standard conditions Fig. 2 with imageFig. S1 with image from Patil et al., 2011
photoreceptor cell morphogenesis disrupted, abnormal WT + MO3-rp2 standard conditions Fig. 2 with imageFig. S1 with image from Patil et al., 2011
photoreceptor cell development disrupted, abnormal WT + MO3-rp2 standard conditions Fig. 2 with imageFig. S1 with image from Patil et al., 2011
retinal cone cell development disrupted, abnormal WT + MO3-rp2 standard conditions Fig. 2 with image from Patil et al., 2011
eye decreased size, abnormal WT + MO3-rp2 standard conditions Fig. 2 with image from Patil et al., 2011
OTHER MO3-rp2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)