header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100908-10
Morpholino Name: MO6-cdh5
Target: cdh5 (1)
Sequence:
5' - AGATGAACCTACCCAGGATGGTAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-cdh5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-cdh5
Expressed Gene Anatomy Figures
cdh5 Fig. 8 with image from Wang et al., 2010
PHENOTYPE
Phenotype resulting from MO6-cdh5
Phenotype of all Fish created by or utilizing MO6-cdh5
Genome Resources:
CITATIONS (2)