ZFIN ID: ZDB-MRPHLNO-100813-1
Morpholino Name: MO1-lbx1a
Target: lbx1a (1)
Previous Name: MO1-lbx1b (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACACCGGGCCTTGTGTTTACCTTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: this morpholino was originally designated lbx1b, however it binds to lbx1a at a splice donor site
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lbx1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lbx1a
Expressed Gene Anatomy Figures
fgf8a ectoderm Fig. 2 with image from Ochi et al., 2009
myod1 (not) pectoral fin musculature, (not) sternohyoid Fig. 2 with image from Ochi et al., 2009
PHENOTYPE 
Phenotype resulting from MO1-lbx1a
No data available

Phenotype of all Fish created by or utilizing MO1-lbx1a
No data available
OTHER MO1-lbx1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)