Morpholino

MO1-sec24d

ID

ZDB-MRPHLNO-100611-1

Name

MO1-sec24d

Previous Names

Sec24d-MO (1)

Target

sec24d (1)

Sequence

5' - CTTACTGTTATACCTCTTTCATTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to 5-prime UTR

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-sec24d

No data available

Phenotype

Phenotype resulting from MO1-sec24d

Phenotype	Fish	Figures
ceratohyal cartilage malformed, abnormal	AB + MO1-sec24d	Fig. 1 from Sarmah et al., 2010
chondrocyte malformed, abnormal	AB + MO1-sec24d	Fig. 1 from Sarmah et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal	AB + MO1-sec24d	Fig. 1 from Sarmah et al., 2010
Meckel's cartilage decreased length, abnormal	AB + MO1-sec24d	Fig. 1 from Sarmah et al., 2010
pectoral fin kinked, abnormal	AB + MO1-sec24d	Fig. 1 from Sarmah et al., 2010
whole organism decreased length, abnormal	AB + MO1-sec24d	Fig. 1 from Sarmah et al., 2010

Phenotype of all Fish created by or utilizing MO1-sec24d

Phenotype	Fish	Conditions	Figures
pectoral fin kinked, abnormal	AB + MO1-sec24d	standard conditions	Fig. 1 from Sarmah et al., 2010
Meckel's cartilage decreased length, abnormal	AB + MO1-sec24d	standard conditions	Fig. 1 from Sarmah et al., 2010
ceratohyal cartilage malformed, abnormal	AB + MO1-sec24d	standard conditions	Fig. 1 from Sarmah et al., 2010
chondrocyte malformed, abnormal	AB + MO1-sec24d	standard conditions	Fig. 1 from Sarmah et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal	AB + MO1-sec24d	standard conditions	Fig. 1 from Sarmah et al., 2010
whole organism decreased length, abnormal	AB + MO1-sec24d	standard conditions	Fig. 1 from Sarmah et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal	AB + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 8 from Sarmah et al., 2010
extracellular matrix constituent secretion decreased occurrence, abnormal	AB + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 8 from Sarmah et al., 2010
auditory capsule malformed, abnormal	AB + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 8 from Sarmah et al., 2010
chondrocyte differentiation arrested, abnormal	AB + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 8 from Sarmah et al., 2010
pectoral fin cartilage malformed, abnormal	AB + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 8 from Sarmah et al., 2010
pharyngeal arch cartilage extracellular matrix decreased volume, abnormal	AB + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 8 from Sarmah et al., 2010
embryonic viscerocranium morphogenesis process quality, abnormal	vu234Tg + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 9 from Sarmah et al., 2010
pharyngeal arch cartilage immature, abnormal	vu234Tg + MO1-sec24d + MO2-sec24c	standard conditions	Fig. 9 from Sarmah et al., 2010

Citations