ZFIN ID: ZDB-MRPHLNO-100527-9
Morpholino Name: MO1-tmx3a
Target: tmx3a (1)
Previous Name: MO1-tmx3

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTTTCTCATGTTTGCCATCTTGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tmx3a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tmx3a
Expressed Gene Anatomy Figures
isl1 Fig. 8 with image from Chao et al., 2010
pax2a Fig. 10 with image from Chao et al., 2010
PHENOTYPE
Phenotype resulting from MO1-tmx3a
Phenotype Figures
eye decreased size, abnormal Fig. 5 with image from Chao et al., 2010
eye malformed, abnormal Fig. 5 with image from Chao et al., 2010

Phenotype of all Fish created by or utilizing MO1-tmx3a
Phenotype Fish Conditions Figures
eye malformed, abnormal WT + MO1-tmx3a standard conditions Fig. 5 with image from Chao et al., 2010
eye decreased size, abnormal WT + MO1-tmx3a standard conditions Fig. 5 with image from Chao et al., 2010
OTHER MO1-tmx3a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)