header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-100520-6
Morpholino Name: MO3-lrrk2
Target: lrrk2 (1)
Sequence:
5' - ACAACTCCTCTATTTCTGCCATGAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targeted to translation-start
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-lrrk2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-lrrk2
Expressed Gene Anatomy Figures
lrrk2 Fig. 1 with imageFig. 6 with image from Prabhudesai et al., 2016
Fig. 3 with image from Sheng et al., 2010
sod1 Fig. 7 with image from Prabhudesai et al., 2016
PHENOTYPE
Phenotype resulting from MO3-lrrk2
Phenotype Figures
brain lrrk2 expression decreased amount, abnormal Fig. 6 with image from Prabhudesai et al., 2016
brain has fewer parts of type dopaminergic neuron, abnormal Fig. 5 with image from Prabhudesai et al., 2016
brain has fewer parts of type neuron, abnormal Fig. 5 with image from Prabhudesai et al., 2016
diencephalon Ab3-sncb labeling increased amount, abnormal Fig. 8 with image from Prabhudesai et al., 2016
eye decreased size, abnormal Fig. 1 with image from Prabhudesai et al., 2016
eye edematous, abnormal Fig. 3 with image from Prabhudesai et al., 2016
eye malformed, abnormal Fig. 1 with image from Prabhudesai et al., 2016
hindbrain Ab3-sncb labeling increased amount, abnormal Fig. 8 with image from Prabhudesai et al., 2016
lens edematous, abnormal Fig. 1 with image from Prabhudesai et al., 2016
midbrain Ab3-sncb labeling increased amount, abnormal Fig. 8 with image from Prabhudesai et al., 2016
optic fissure open, abnormal Fig. 1 with image from Prabhudesai et al., 2016
otic vesicle edematous, abnormal Fig. 1 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal Fig. 1 with imageFig. 3 with imageFig. 5 with image from Prabhudesai et al., 2016
post-vent region cell death increased occurrence, abnormal Fig. 5 with image from Prabhudesai et al., 2016
postoptic commissure Ab3-sncb labeling increased amount, abnormal Fig. 8 with image from Prabhudesai et al., 2016
pronephric duct apicolateral plasma membrane ab1-atp1a1 labeling mislocalised, abnormal Fig. 9 with image from Prabhudesai et al., 2016
pronephric duct kidney epithelium development process quality, abnormal Fig. 9 with image from Prabhudesai et al., 2016
spinal cord has fewer parts of type neuron, abnormal Fig. 5 with image from Prabhudesai et al., 2016
whole organism lrrk2 expression decreased amount, abnormal Fig. 1 with image from Prabhudesai et al., 2016
whole organism Ab3-sncb labeling increased amount, abnormal Fig. 7 with image from Prabhudesai et al., 2016
whole organism sod1 expression increased amount, abnormal Fig. 7 with image from Prabhudesai et al., 2016
whole organism Ab1-htra2 labeling increased amount, abnormal Fig. 7 with image from Prabhudesai et al., 2016

Phenotype of all Fish created by or utilizing MO3-lrrk2
Phenotype Fish Conditions Figures
pronephric duct kidney epithelium development process quality, abnormal AB + MO3-lrrk2 standard conditions Fig. 9 with image from Prabhudesai et al., 2016
whole organism lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
diencephalon Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
otic vesicle edematous, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
whole organism Ab1-htra2 labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
postoptic commissure Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
pronephric duct apicolateral plasma membrane ab1-atp1a1 labeling mislocalised, abnormal AB + MO3-lrrk2 standard conditions Fig. 9 with image from Prabhudesai et al., 2016
eye malformed, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
midbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
whole organism Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
lens edematous, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
brain lrrk2 expression decreased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 6 with image from Prabhudesai et al., 2016
whole organism sod1 expression increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 7 with image from Prabhudesai et al., 2016
post-vent region cell death increased occurrence, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
spinal cord has fewer parts of type neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
hindbrain Ab3-sncb labeling increased amount, abnormal AB + MO3-lrrk2 standard conditions Fig. 8 with image from Prabhudesai et al., 2016
brain has fewer parts of type neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with imageFig. 5 with image from Prabhudesai et al., 2016
optic fissure open, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
brain has fewer parts of type dopaminergic neuron, abnormal AB + MO3-lrrk2 standard conditions Fig. 5 with image from Prabhudesai et al., 2016
eye decreased size, abnormal AB + MO3-lrrk2 standard conditions Fig. 1 with image from Prabhudesai et al., 2016
eye edematous, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
post-vent region bent, abnormal AB + MO3-lrrk2 + MO4-tp53 standard conditions Fig. 3 with image from Prabhudesai et al., 2016
OTHER MO3-lrrk2 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)