Morpholino

MO2-lbx2

ID
ZDB-MRPHLNO-100429-8
Name
MO2-lbx2
Previous Names
None
Target
Sequence
5' - TTATGAACTTTTTACCTTCTGCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lbx2
Expressed Gene Anatomy Figures
acta1a Fig. 6 with image,  Fig. 7 with image from Ochi et al., 2009
fgf8a Fig. 2 with image from Ochi et al., 2009
mef2ca Fig. 7 with image from Ochi et al., 2009
mybpc1 Fig. 6 with image,  Fig. 7 with image from Ochi et al., 2009
myf5 Fig. 3 with image from Ochi et al., 2009
myhz1.1 Fig. 6 with image from Ochi et al., 2009
myhz2 Fig. 6 with image from Ochi et al., 2009
mylpfa Fig. 6 with image from Ochi et al., 2009
myod1 Fig. 2 with image,  Fig. 3 with image from Ochi et al., 2009
myog Fig. 7 with image from Ochi et al., 2009
prox1a Fig. 4 with image from Ochi et al., 2009
smyhc1 Fig. 6 with image from Ochi et al., 2009
tnnc2.2 Fig. 6 with image from Ochi et al., 2009
tnnt1 Fig. 6 with image from Ochi et al., 2009
tnnt3b Fig. 6 with image from Ochi et al., 2009
tpma Fig. 6 with image from Ochi et al., 2009
Phenotype
Phenotype resulting from MO2-lbx2
Phenotype Fish Figures
adaxial cell morphology, abnormal WT + MO2-lbx2 Fig. 3 with image from Ochi et al., 2009
fast muscle cell unfused from fast muscle cell, abnormal WT + MO2-lbx2 Fig. 5 with image from Ochi et al., 2009
fast muscle cell myofibril decreased length, abnormal WT + MO2-lbx2 Fig. 5 with image from Ochi et al., 2009
muscle pioneer myofibril decreased length, abnormal WT + MO2-lbx2 Fig. 4 with image from Ochi et al., 2009
muscle pioneer myofibril decreased thickness, abnormal WT + MO2-lbx2 Fig. 4 with image from Ochi et al., 2009
slow muscle cell myofibril decreased length, abnormal WT + MO2-lbx2 Fig. 4 with image from Ochi et al., 2009
slow muscle cell myofibril decreased thickness, abnormal WT + MO2-lbx2 Fig. 4 with image from Ochi et al., 2009
Phenotype of all Fish created by or utilizing MO2-lbx2
Phenotype Fish Conditions Figures
fast muscle cell unfused from fast muscle cell, abnormal WT + MO2-lbx2 standard conditions Fig. 5 with image from Ochi et al., 2009
slow muscle cell myofibril decreased thickness, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
fast muscle cell myofibril decreased length, abnormal WT + MO2-lbx2 standard conditions Fig. 5 with image from Ochi et al., 2009
muscle pioneer myofibril decreased length, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
muscle pioneer myofibril decreased thickness, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
slow muscle cell myofibril decreased length, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
adaxial cell morphology, abnormal WT + MO2-lbx2 standard conditions Fig. 3 with image from Ochi et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.