ZFIN ID: ZDB-MRPHLNO-100429-8
Morpholino Name: MO2-lbx2
Target: lbx2 (1)
Sequence:
5' - TTATGAACTTTTTACCTTCTGCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice blocker
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-lbx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-lbx2
Expressed Gene Anatomy Figures
acta1a Fig. 6 with imageFig. 7 with image from Ochi et al., 2009
fgf8a Fig. 2 with image from Ochi et al., 2009
mef2ca Fig. 7 with image from Ochi et al., 2009
mybpc1 Fig. 6 with imageFig. 7 with image from Ochi et al., 2009
myf5 Fig. 3 with image from Ochi et al., 2009
myhz1.1 Fig. 6 with image from Ochi et al., 2009
myhz2 Fig. 6 with image from Ochi et al., 2009
mylpfa Fig. 6 with image from Ochi et al., 2009
myod1 Fig. 2 with imageFig. 3 with image from Ochi et al., 2009
myog Fig. 7 with image from Ochi et al., 2009
prox1a Fig. 4 with image from Ochi et al., 2009
smyhc1 Fig. 6 with image from Ochi et al., 2009
tnnc2 Fig. 6 with image from Ochi et al., 2009
tnnt1 Fig. 6 with image from Ochi et al., 2009
tnnt3b Fig. 6 with image from Ochi et al., 2009
tpma Fig. 6 with image from Ochi et al., 2009
PHENOTYPE
Phenotype resulting from MO2-lbx2
Phenotype Figures
adaxial cell morphology, abnormal Fig. 3 with image from Ochi et al., 2009
fast muscle cell unfused from fast muscle cell, abnormal Fig. 5 with image from Ochi et al., 2009
fast muscle cell myofibril decreased length, abnormal Fig. 5 with image from Ochi et al., 2009
muscle pioneer myofibril decreased length, abnormal Fig. 4 with image from Ochi et al., 2009
muscle pioneer myofibril decreased thickness, abnormal Fig. 4 with image from Ochi et al., 2009
slow muscle cell myofibril decreased length, abnormal Fig. 4 with image from Ochi et al., 2009
slow muscle cell myofibril decreased thickness, abnormal Fig. 4 with image from Ochi et al., 2009

Phenotype of all Fish created by or utilizing MO2-lbx2
Phenotype Fish Conditions Figures
fast muscle cell unfused from fast muscle cell, abnormal WT + MO2-lbx2 standard conditions Fig. 5 with image from Ochi et al., 2009
fast muscle cell myofibril decreased length, abnormal WT + MO2-lbx2 standard conditions Fig. 5 with image from Ochi et al., 2009
slow muscle cell myofibril decreased thickness, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
muscle pioneer myofibril decreased length, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
muscle pioneer myofibril decreased thickness, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
slow muscle cell myofibril decreased length, abnormal WT + MO2-lbx2 standard conditions Fig. 4 with image from Ochi et al., 2009
adaxial cell morphology, abnormal WT + MO2-lbx2 standard conditions Fig. 3 with image from Ochi et al., 2009
OTHER MO2-lbx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)