Morpholino

MO7-tp53

ID
ZDB-MRPHLNO-100415-11
Name
MO7-tp53
Previous Names
  • MO15-tp53
  • p53 MO (1)
Target
Sequence
5' - TCTTGGCTGTCGTTTTGCGCCATTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-tp53
Phenotype
Phenotype resulting from MO7-tp53
No data available
Phenotype of all Fish created by or utilizing MO7-tp53
Phenotype Fish Conditions Figures
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal cdkn2aipcas009/cas009 + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
definitive hemopoiesis decreased occurrence, abnormal cdkn2aipcas009/cas009 + MO7-tp53 control Fig. 5 with image from He et al., 2017
hematopoietic stem cell myb expression decreased amount, abnormal cdkn2aipcas009/cas009 + MO7-tp53 control Fig. 5 with image from He et al., 2017
liver fabp1a expression spatial pattern, ameliorated cebparj31/+ + MO7-tp53 standard conditions Fig. 5 with image from Yuan et al., 2015
blood island hematopoietic stem cell decreased amount, abnormal kri1cas002/cas002 + MO7-tp53 standard conditions Fig. S12 with image from Jia et al., 2015
presumptive ventral mesoderm cdx4 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
canonical Wnt signaling pathway decreased process quality, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
presumptive ventral mesoderm tbx6 expression decreased amount, abnormal TU + MO1-cdkn2aip + MO1-wnt8a + MO2-wnt8a + MO7-tp53 control Fig. 4 with image from He et al., 2017
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-ube2ia + MO2-ube2ib + MO7-tp53 standard conditions Fig. 1 with image from Yuan et al., 2015
apoptotic process decreased occurrence, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a + MO7-tp53 standard conditions Fig. 4 from Yuan et al., 2010
hematopoietic multipotent progenitor cell decreased amount, abnormal WT + MO1-sumo1 + MO1-sumo2b + MO1-sumo3a + MO7-tp53 standard conditions Fig. 1 with image from Yuan et al., 2015
Citations