ZFIN ID: ZDB-MRPHLNO-090609-10
Morpholino Name: MO1-yap1
Target: yap1 (1)
Sequence:
5' - AGCAACATTAACAACTCACTTTAGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: 2e2i
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-yap1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-yap1
Expressed Gene Anatomy Figures
ccn2a Fig. 4 with image from Fukui et al., 2014
foxa2 Fig. 2 with image from Fukui et al., 2014
ins Fig. S7 from Cebola et al., 2015
myl7 Fig. 1 with image from Fukui et al., 2014
pdx1 Fig. 7 from Cebola et al., 2015
sox9b Fig. 7 from Cebola et al., 2015
sox17 Fig. 4 with image from Fukui et al., 2014
PHENOTYPE
Phenotype resulting from MO1-yap1
Phenotype Figures
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal Fig. 1 with imageFig. 2 with imageFig. 3 with image from Fukui et al., 2014
endoderm cellular quality, abnormal Fig. 4 with image from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal Fig. 3 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal Fig. 2 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal Fig. 3 with image from Fukui et al., 2014
eye decreased size, abnormal Fig. 4 from Miesfeld et al., 2014
heart d2EGFP expression decreased amount, abnormal Fig. 4 from Miesfeld et al., 2014
heart malformed, abnormal Fig. 1 with image from Fukui et al., 2014
heart split bilaterally, abnormal Fig. 1 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal Fig. 1 with imageFig. 2 with imageFig. 3 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal Fig. 1 with imageFig. 2 with imageFig. 3 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal Fig. 1 with imageFig. 2 with image from Fukui et al., 2014
pancreas development disrupted, abnormal Fig. 7 from Cebola et al., 2015
pancreatic bud decreased size, abnormal Fig. 7 from Cebola et al., 2015
pancreatic bud lacks parts or has fewer parts of type cell, abnormal Fig. 7 from Cebola et al., 2015
pharyngeal endoderm mislocalised laterally, abnormal Fig. 2 with image from Fukui et al., 2014
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal Fig. 5 with imageFig. 6 with image from Agarwala et al., 2015
posterior pancreatic bud decreased size, abnormal Fig. S7 from Cebola et al., 2015
pronephros cystic, abnormal Fig. 3 with image from Skouloudaki et al., 2009
retinal pigmented epithelium d2EGFP expression decreased amount, abnormal Fig. 4 from Miesfeld et al., 2014
trunk musculature striated muscle cell d2EGFP expression decreased amount, abnormal Fig. 4 from Miesfeld et al., 2014
whole organism has extra parts of type posterior pancreatic bud, abnormal Fig. S7 from Cebola et al., 2015

Phenotype of all Fish created by or utilizing MO1-yap1
Phenotype Fish Conditions Figures
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal AB + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal AB + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
pharyngeal endoderm mislocalised laterally, abnormal AB + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
endoderm cellular quality, abnormal AB + MO1-yap1 standard conditions Fig. 4 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal AB + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
pancreatic bud lacks parts or has fewer parts of type cell, abnormal WT + MO1-yap1 standard conditions Fig. 7 from Cebola et al., 2015
pancreas development disrupted, abnormal WT + MO1-yap1 standard conditions Fig. 7 from Cebola et al., 2015
whole organism has extra parts of type posterior pancreatic bud, abnormal WT + MO1-yap1 control Fig. S7 from Cebola et al., 2015
posterior pancreatic bud decreased size, abnormal WT + MO1-yap1 control Fig. S7 from Cebola et al., 2015
pronephros cystic, abnormal WT + MO1-yap1 standard conditions Fig. 3 with image from Skouloudaki et al., 2009
pancreatic bud decreased size, abnormal WT + MO1-yap1 standard conditions Fig. 7 from Cebola et al., 2015
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm cellular quality, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 4 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg + MO1-yap1 standard conditions Fig. 3 with image from Fukui et al., 2014
trunk musculature striated muscle cell d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
retinal pigmented epithelium d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
heart d2EGFP expression decreased amount, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
eye decreased size, abnormal mw50Tg + MO1-yap1 + MO4-tp53 standard conditions Fig. 4 from Miesfeld et al., 2014
heart malformed, abnormal ncv10Tg + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
heart split bilaterally, abnormal ncv10Tg + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ncv10Tg + MO1-yap1 standard conditions Fig. 1 with image from Fukui et al., 2014
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal zf106Tg + MO1-yap1 standard conditions Fig. 5 with imageFig. 6 with image from Agarwala et al., 2015
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 standard conditions Fig. 2 with image from Fukui et al., 2014
posterior lateral line primordium has number of posterior lateral line primordium cell, ameliorated zf106Tg + MO1-amotl2a + MO1-yap1 standard conditions Fig. 6 with image from Agarwala et al., 2015
posterior lateral line primordium cell population proliferation occurrence, ameliorated zf106Tg + MO1-amotl2a + MO1-yap1 standard conditions Fig. 6 with image from Agarwala et al., 2015
heart split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a standard conditions Fig. 4 with image from Fukui et al., 2014
rhombomere cell population proliferation decreased occurrence, abnormal mw50Tg ; wwtr1fu55/+ + MO1-yap1 + MO4-tp53 control Fig. 5 from Voltes et al., 2019
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
Genome Resources:
CITATIONS (10)