Morpholino

MO1-elp3

ID
ZDB-MRPHLNO-090216-1
Name
MO1-elp3
Previous Names
None
Target
Sequence
5' - TGGCTTTCCCATCTTAGACACAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-elp3
Phenotype
Phenotype resulting from MO1-elp3
Phenotype of all Fish created by or utilizing MO1-elp3
Phenotype Fish Conditions Figures
motor neuron axon decreased length, abnormal AB + MO1-elp3 standard conditions Fig. S5 from Bento-Abreu et al., 2018
trunk curved ventral, abnormal WT + MO1-elp3 standard conditions Figure 1 with imageFigure 5 with image from Rojas-Benítez et al., 2020
whole organism elp3 expression decreased amount, abnormal WT + MO1-elp3 control Figure 1 with image from Rojas-Benítez et al., 2020
notochord col2a1a expression decreased amount, abnormal WT + MO1-elp3 standard conditions Figure 4 with image from Rojas-Benítez et al., 2020
adaxial cell ab1-eng labeling decreased amount, abnormal WT + MO1-elp3 standard conditions Figure 4 with image from Rojas-Benítez et al., 2020
post-vent region curved ventral, abnormal WT + MO1-elp3 standard conditions Figure 1 with imageFigure 5 with image from Rojas-Benítez et al., 2020
motor neuron axon branched, abnormal WT + MO1-elp3 standard conditions Fig. 4 from Simpson et al., 2009
somite fast muscle cell disorganized, abnormal WT + MO1-elp3 standard conditions Figure 3 with image from Rojas-Benítez et al., 2020
somite morphology, abnormal WT + MO1-elp3 standard conditions Figure 2 with image from Rojas-Benítez et al., 2020
somite slow muscle cell undulate, abnormal WT + MO1-elp3 standard conditions Figure 3 with image from Rojas-Benítez et al., 2020
muscle cell disorganized, abnormal WT + MO1-elp3 standard conditions Figure 2 with image from Rojas-Benítez et al., 2020
motor neuron axon decreased length, abnormal WT + MO1-elp3 standard conditions Fig. 4 from Simpson et al., 2009
somite decreased area, abnormal WT + MO1-elp3 standard conditions Figure 2 with image from Rojas-Benítez et al., 2020
trunk curved, ameliorated WT + MO1-elp3 chemical treatment by injection: purmorphamine Figure 5 with image from Rojas-Benítez et al., 2020
somite slow muscle cell morphology, abnormal WT + MO1-elp3 standard conditions Figure 3 with image from Rojas-Benítez et al., 2020
horizontal myoseptum morphology, abnormal WT + MO1-elp3 standard conditions Figure 2 with image from Rojas-Benítez et al., 2020
post-vent region curved, ameliorated WT + MO1-elp3 chemical treatment by injection: purmorphamine Figure 5 with image from Rojas-Benítez et al., 2020
Citations