header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-090109-1
Morpholino Name: MO1-il1rapl1b
Target: il1rapl1b (1)
Sequence:
5' - GATGCAGCGATCACCGTCCCAAAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking morpholino complementary to nt -25 to -1 of il1rapl1b.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-il1rapl1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-il1rapl1b No data available
PHENOTYPE
Phenotype resulting from MO1-il1rapl1b
Phenotype of all Fish created by or utilizing MO1-il1rapl1b
Genome Resources:
CITATIONS (1)