ZFIN ID: ZDB-MRPHLNO-081105-2
Morpholino Name: MO3-sparc
Target: sparc (1)
Previous Name: E3I3-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAAAAATGAACTCACTCTCAGCAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-sparc No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-sparc
Expressed Gene Anatomy Figures
atp1a1a.4 anterior crista primordium, dorsolateral septum, (not) lateral crista primordium (all 4) expand Fig. 7Fig. 8 from Rotllant et al., 2008
cldna otic vesicle Fig. 6 from Rotllant et al., 2008
col2a1a chondrocyte, cranial cartilage, (not) notochord (all 4) expand Fig. 4Fig. 8 from Rotllant et al., 2008
dlx2a chondrocranium cartilage, cranial neural crest cell, mandibular arch skeleton (all 5) expand Fig. 4 from Rotllant et al., 2008
dlx3b otic vesicle Fig. 6 from Rotllant et al., 2008
eya1 otic vesicle Fig. 6 from Rotllant et al., 2008
gata1a anatomical structure, blood island, intermediate cell mass of mesoderm Fig. 2 from Ceinos et al., 2013
hbbe3 anatomical structure, erythroid lineage cell Fig. 2 from Ceinos et al., 2013
lcp1 myeloid cell Fig. 2 from Ceinos et al., 2013
msx3 anterior crista primordium, (not) lateral crista primordium, posterior crista primordium Fig. 7Fig. 8 from Rotllant et al., 2008
myb anterior lateral mesoderm, hematopoietic system, intermediate cell mass of mesoderm (all 4) expand Fig. 3 from Ceinos et al., 2013
otx1b (not) otic vesicle Fig. 6Fig. 8 from Rotllant et al., 2008
rag1 thymus Fig. 2 from Ceinos et al., 2013
runx1 anterior lateral mesoderm, blood island, hematopoietic system (all 5) expand Fig. 4 from Ceinos et al., 2013
sox9a chondrocranium cartilage, otic vesicle, pharyngeal arch Fig. 4 from Rotllant et al., 2008
sox9b chondrocranium cartilage, rhombomere Fig. 4 from Rotllant et al., 2008
sparc whole organism Fig. 3 from Rotllant et al., 2008
spi1b anterior lateral mesoderm, intermediate cell mass of mesoderm Fig. 2 from Ceinos et al., 2013
stm otic vesicle Fig. 6 from Rotllant et al., 2008
PHENOTYPE 
Phenotype resulting from MO3-sparc
Phenotype Figures
anatomical structure hbbe3 expression decreased amount, abnormal Fig. 2 from Ceinos et al., 2013
anatomical structure gata1a expression decreased amount, abnormal Fig. 2 from Ceinos et al., 2013
anterior macula position, abnormal Fig. 7 from Rotllant et al., 2008
anterior semicircular canal aplastic, abnormal Fig. 7 from Rotllant et al., 2008
blood island gata1a expression decreased amount, abnormal Fig. 2 from Ceinos et al., 2013
ceratobranchial cartilage aplastic, abnormal Fig. 4Fig. 8 from Rotllant et al., 2008
ceratohyal cartilage aplastic, abnormal Fig. 4 from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal Fig. 4Fig. 8 from Rotllant et al., 2008
chondrocranium cartilage decreased size, abnormal Fig. 4 from Rotllant et al., 2008
cranial cartilage morphology, abnormal Fig. 4 from Rotllant et al., 2008
erythrocyte differentiation decreased occurrence, abnormal Fig. 2 from Ceinos et al., 2013
erythroid lineage cell hbbe3 expression decreased amount, abnormal Fig. 2 from Ceinos et al., 2013
immature posterior macula aplastic, abnormal Fig. 6Fig. 8 from Rotllant et al., 2008
inner ear decreased size, abnormal Fig. 7 from Rotllant et al., 2008
inner ear morphogenesis disrupted, abnormal Fig. 7Fig. 8 from Rotllant et al., 2008
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal Fig. 2 from Ceinos et al., 2013
intermediate cell mass of mesoderm cell proliferation increased occurrence, abnormal Fig. 5 from Ceinos et al., 2013
lateral crista primordium aplastic, abnormal Fig. 7Fig. 8 from Rotllant et al., 2008
lateral semicircular canal aplastic, abnormal Fig. 7 from Rotllant et al., 2008
Meckel's cartilage aplastic, abnormal Fig. 4Fig. 8 from Rotllant et al., 2008
Meckel's cartilage decreased size, abnormal Fig. 4 from Rotllant et al., 2008
notochord morphology, abnormal Fig. 8 from Rotllant et al., 2008
otic vesicle formation disrupted, abnormal Fig. 6Fig. 8 from Rotllant et al., 2008
pectoral fin decreased size, abnormal Fig. 4 from Rotllant et al., 2008
pectoral fin kinked, abnormal Fig. 4 from Rotllant et al., 2008
pectoral fin cartilage morphology, abnormal Fig. 4 from Rotllant et al., 2008
posterior macula position, abnormal Fig. 7 from Rotllant et al., 2008
posterior semicircular canal aplastic, abnormal Fig. 7 from Rotllant et al., 2008
trunk apoptotic process increased occurrence, abnormal Fig. 5 from Ceinos et al., 2013
ventral mandibular arch decreased size, abnormal Fig. 4 from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal Fig. 4 from Rotllant et al., 2008
whole organism curved dorsal, abnormal Fig. 8 from Rotllant et al., 2008
whole organism decreased length, abnormal Fig. 4 from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal text only from Rotllant et al., 2008

Phenotype of all Fish created by or utilizing MO3-sparc
Phenotype Fish Conditions Figures
inner ear decreased size, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
intermediate cell mass of mesoderm cell proliferation increased occurrence, abnormal AB + MO3-sparc control Fig. 5 from Ceinos et al., 2013
blood island gata1a expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
erythroid lineage cell hbbe3 expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
anterior macula position, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
inner ear morphogenesis disrupted, abnormal AB + MO3-sparc standard conditions Fig. 7Fig. 8 from Rotllant et al., 2008
posterior semicircular canal aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
chondrocranium cartilage decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
lateral crista primordium aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7Fig. 8 from Rotllant et al., 2008
pectoral fin decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
ceratohyal cartilage aplastic, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
Meckel's cartilage decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
anatomical structure gata1a expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
whole organism decreased length, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
otic vesicle formation disrupted, abnormal AB + MO3-sparc standard conditions Fig. 6Fig. 8 from Rotllant et al., 2008
lateral semicircular canal aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
immature posterior macula aplastic, abnormal AB + MO3-sparc standard conditions Fig. 6Fig. 8 from Rotllant et al., 2008
ventral mandibular arch decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
vestibuloauditory system functionality, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
whole organism curved dorsal, abnormal AB + MO3-sparc standard conditions Fig. 8 from Rotllant et al., 2008
anatomical structure hbbe3 expression decreased amount, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
notochord morphology, abnormal AB + MO3-sparc standard conditions Fig. 8 from Rotllant et al., 2008
pectoral fin kinked, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
posterior macula position, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
erythrocyte differentiation decreased occurrence, abnormal AB + MO3-sparc control Fig. 2 from Ceinos et al., 2013
pectoral fin cartilage morphology, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
anterior semicircular canal aplastic, abnormal AB + MO3-sparc standard conditions Fig. 7 from Rotllant et al., 2008
cranial cartilage morphology, abnormal AB + MO3-sparc standard conditions Fig. 4 from Rotllant et al., 2008
trunk apoptotic process increased occurrence, abnormal AB + MO3-sparc control Fig. 5 from Ceinos et al., 2013
ceratobranchial cartilage aplastic, abnormal AB + MO3-sparc standard conditions Fig. 4Fig. 8 from Rotllant et al., 2008
whole organism lethal (sensu genetics), abnormal AB + MO3-sparc standard conditions text only from Rotllant et al., 2008
Meckel's cartilage aplastic, abnormal AB + MO3-sparc standard conditions Fig. 4Fig. 8 from Rotllant et al., 2008
ceratohyal cartilage decreased size, abnormal AB + MO3-sparc standard conditions Fig. 4Fig. 8 from Rotllant et al., 2008
OTHER MO3-sparc MORPHOLINO PAGESNo links to external sites
CITATIONS (2)