header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-081016-2
Morpholino Name: MO1-appl1
Target: appl1 (1)
Sequence:
5' - CAGGTCAAACGCGAACTATGCGATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-appl1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-appl1
Expressed Gene Anatomy Figures
appl1 Fig. 3 with imageFig. 4 with imageFig. 5 with image from Schenck et al., 2008
PHENOTYPE
Phenotype resulting from MO1-appl1
Phenotype of all Fish created by or utilizing MO1-appl1
Genome Resources:
CITATIONS (1)