header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080908-1
Morpholino Name: MO2-jun
Target: jun (1)
Previous Name: c-Jun MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTTGGTAGACATAGAAGGCAAAGCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-jun No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-jun
Expressed Gene Anatomy Figures
tbx16l Fig. 3 from Gan et al., 2008
tbxta Fig. 3 from Gan et al., 2008
vox Fig. 3 from Gan et al., 2008
PHENOTYPE
Phenotype resulting from MO2-jun
Phenotype of all Fish created by or utilizing MO2-jun
Phenotype Fish Conditions Figures
telencephalon increased size, abnormal TU + MO2-jun standard conditions Fig. 3 from Gan et al., 2008
head increased size, abnormal TU + MO2-jun standard conditions Fig. 3 from Gan et al., 2008
whole organism wholly anterioralized, abnormal TU + MO2-jun standard conditions Fig. 3 from Gan et al., 2008
post-vent region decreased size, abnormal TU + MO2-jun standard conditions Fig. 3 from Gan et al., 2008
brain sox2 expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
brain morphology, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain pax7a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
brain ascl1a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
brain pax3a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
apoptotic process process quality, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain nanog expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
midbrain hindbrain boundary morphology, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain development process quality, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 7 with image from Han et al., 2016
brain pax6a expression amount, ameliorated WT + MO1-trim69 + MO2-jun standard conditions Fig. 8 with image from Han et al., 2016
OTHER MO2-jun MORPHOLINO PAGESNo links to external sites
CITATIONS (2)