ZFIN ID: ZDB-MRPHLNO-080501-3
Morpholino Name: MO3-cyp26a1
Target: cyp26a1 (1)
Sequence:
5' - CGCAACTGATCGCCAAAACGAAAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cyp26a1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cyp26a1
Expressed Gene Anatomy Figures
hnf1ba Fig. 2 from Gongal et al., 2008
meis3 Fig. 2 from Gongal et al., 2008
tbxta Fig. 2 from Gongal et al., 2008
PHENOTYPE
Phenotype resulting from MO3-cyp26a1
No data available

Phenotype of all Fish created by or utilizing MO3-cyp26a1
No data available
OTHER MO3-cyp26a1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)