ZFIN ID: ZDB-MRPHLNO-080319-1
Morpholino Name: MO1-itgb1a
Target: itgb1a (1)
Sequence:
5' - TATGAAAAGTAGCTTCAGGTCCATC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-itgb1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-itgb1a No data available
PHENOTYPE
Phenotype resulting from MO1-itgb1a
Phenotype Figures
dorsal longitudinal anastomotic vessel blood vessel morphogenesis decreased occurrence, abnormal Fig. 6 with image from Wang et al., 2016
intersegmental vessel decreased length, abnormal Fig. 6 with image from Wang et al., 2016
sprouting angiogenesis decreased occurrence, abnormal Fig. 6 with image from Wang et al., 2016

Phenotype of all Fish created by or utilizing MO1-itgb1a
Phenotype Fish Conditions Figures
dorsal longitudinal anastomotic vessel blood vessel morphogenesis decreased occurrence, abnormal s843Tg + MO1-itgb1a standard conditions Fig. 6 with image from Wang et al., 2016
intersegmental vessel decreased length, abnormal s843Tg + MO1-itgb1a standard conditions Fig. 6 with image from Wang et al., 2016
sprouting angiogenesis decreased occurrence, abnormal s843Tg + MO1-itgb1a standard conditions Fig. 6 with image from Wang et al., 2016
intersegmental vessel decreased length, abnormal s916Tg; y7Tg + MO1-itgb1a standard conditions Fig. 7 with image from Wang et al., 2016
intersegmental vessel endothelial cell decreased amount, abnormal s916Tg; y7Tg + MO1-itgb1a standard conditions Fig. 7 with image from Wang et al., 2016
intersegmental vessel decreased length, ameliorated s916Tg; y7Tg + MO1-itgb1a + MO3-dll4 standard conditions Fig. 7 with image from Wang et al., 2016
intersegmental vessel endothelial cell amount, ameliorated s916Tg; y7Tg + MO1-itgb1a + MO3-dll4 standard conditions Fig. 7 with image from Wang et al., 2016
OTHER MO1-itgb1a MORPHOLINO PAGESNo links to external sites
CITATIONS (3)