header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070615-4
Morpholino Name: MO4-dnmt1
Target: dnmt1 (1)
Sequence:
5' - ACAATGAGGTCTTGGTAGGCATTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-dnmt1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-dnmt1
Expressed Gene Anatomy Figures
ascl1a Fig. 1 with image from Rai et al., 2010
ascl1b Fig. 1 with image from Rai et al., 2010
atoh7 Fig. 3 with image from Rai et al., 2010
cdh1 Fig. 4 from Wang et al., 2017
crx Fig. 3 with image from Rai et al., 2010
dkk1b Fig. 4 from Wang et al., 2017
dusp6 Fig. 4 from Wang et al., 2017
fabp2 Fig. 2 with image from Rai et al., 2010
Fig. 2Fig. 7 from Rai et al., 2006
fabp10a Fig. 2 with image from Rai et al., 2010
Fig. 2 from Rai et al., 2006
fgf8a Fig. 4 from Wang et al., 2017
foxa3 Fig. 1 from Rai et al., 2006
foxj1a Fig. 3 from Wang et al., 2017
gata5 Fig. 4 from Wang et al., 2017
gata6 Fig. 2 with image from Rai et al., 2010
Fig. 1 from Rai et al., 2006
hand2 Fig. 2 with image from Rai et al., 2010
hnf1ba Fig. 1 from Rai et al., 2006
id3 Fig. 4 from Wang et al., 2017
ins Fig. 2 with image from Rai et al., 2010
Fig. 6 with image from Anderson et al., 2009
Fig. 2 from Rai et al., 2006
lcp1 Fig. 4 from Deveau et al., 2015
lef1 Fig. 5 with image from Rai et al., 2010
lft2 Fig. 4 from Wang et al., 2017
myb Fig. 4 from Deveau et al., 2015
Fig. 3 with imageFig. 5 with image from Liu et al., 2015
neurod1 Fig. 3 with image from Rai et al., 2010
neurog1 Fig. 1 with image from Rai et al., 2010
nkx2.5 Fig. 2 from Wang et al., 2017
opn1sw1 Fig. 2 with image from Rai et al., 2010
opn1sw2 Fig. 2 with image from Rai et al., 2010
otx2b Fig. 3 from Rai et al., 2006
otx5 Fig. 3 from Rai et al., 2006
pax6b Fig. 3 with image from Rai et al., 2010
pcna Fig. 3 with image from Rai et al., 2010
pitx2 Fig. 4 from Wang et al., 2017
prss1 Fig. 2 with imageFig. 7 with image from Rai et al., 2010
rbp3 Fig. 2 with imageFig. 7 with image from Rai et al., 2010
Fig. 3Fig. 7 from Rai et al., 2006
runx1 Fig. 4 from Deveau et al., 2015
sox17 Fig. 3 from Wang et al., 2017
tbxta Fig. 4 from Wang et al., 2017
trp Fig. 2Fig. 7 from Rai et al., 2006
PHENOTYPE
Phenotype resulting from MO4-dnmt1
Phenotype Figures
camera-type eye photoreceptor cell differentiation disrupted, abnormal Fig. 2 with image from Rai et al., 2010
definitive hemopoiesis process quality, abnormal Fig. 3 with imageFig. 5 with image from Liu et al., 2015
determination of heart left/right asymmetry disrupted, abnormal Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry process quality, abnormal Fig. 4 from Wang et al., 2017
determination of liver left/right asymmetry disrupted, abnormal Fig. EV2 from Wang et al., 2017
determination of pancreatic left/right asymmetry disrupted, abnormal Fig. EV2 from Wang et al., 2017
DNA methylation on cytosine decreased occurrence, abnormal text only from Rai et al., 2006
DNA methylation on cytosine increased occurrence, abnormal Fig. 5 with image from Rai et al., 2010
embryonic viscerocranium morphogenesis disrupted, abnormal Fig. 2 with image from Rai et al., 2010
exocrine pancreas hypoplastic, abnormal Fig. 3 with image from Anderson et al., 2009
exocrine pancreas undifferentiated, abnormal Fig. 2 from Rai et al., 2006
exocrine pancreas development disrupted, abnormal Fig. 2 from Rai et al., 2006
forerunner cell group decreased amount, abnormal Fig. 3Fig. 4 from Wang et al., 2017
forerunner cell group sox17 expression decreased amount, abnormal Fig. 3 from Wang et al., 2017
forerunner cell group foxj1a expression decreased amount, abnormal Fig. 3 from Wang et al., 2017
forerunner cell group lft2 expression increased amount, abnormal Fig. 4 from Wang et al., 2017
heart jogging disrupted, abnormal Fig. 2 from Wang et al., 2017
heart looping process quality, abnormal Fig. 2Fig. 4 from Wang et al., 2017
heart tube position, abnormal Fig. 2 from Wang et al., 2017
hematopoietic stem cell myb expression decreased distribution, abnormal Fig. 3 with imageFig. 5 with image from Liu et al., 2015
hemopoiesis disrupted, abnormal Fig. 4 from Deveau et al., 2015
hepatocyte mislocalised posteriorly, abnormal Fig. 3 with image from Anderson et al., 2009
histone H3-K9 methylation decreased occurrence, abnormal Fig. 4 from Rai et al., 2006
intestinal epithelium undifferentiated, abnormal Fig. 2 from Rai et al., 2006
intestinal epithelium gut endothelial cell absent, abnormal Fig. 1 from Rai et al., 2006
Kupffer's vesicle decreased fluid flow, abnormal Fig. 3 from Wang et al., 2017
Kupffer's vesicle structure, cavities, abnormal Fig. 3 from Wang et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal Fig. 3 from Wang et al., 2017
Kupffer's vesicle cilium decreased length, abnormal Fig. 3 from Wang et al., 2017
liver hypoplastic, abnormal Fig. 3 with image from Anderson et al., 2009
liver position, abnormal Fig. EV2 from Wang et al., 2017
mandibular arch skeleton aplastic, abnormal Fig. 1 from Rai et al., 2006
myeloid cell lcp1 expression decreased amount, abnormal Fig. 4 from Deveau et al., 2015
pancreas position, abnormal Fig. EV2 from Wang et al., 2017
pericardium edematous, abnormal Fig. 1 from Rai et al., 2006
pharyngeal arch 2 skeleton aplastic, abnormal Fig. 1 from Rai et al., 2006
post-vent region curved ventral, abnormal Fig. 1 from Rai et al., 2006
retina disorganized, abnormal Fig. 3 from Rai et al., 2006
retina development in camera-type eye disrupted, abnormal Fig. 3 from Rai et al., 2006
retina layer formation disrupted, abnormal Fig. 3 with image from Rai et al., 2010
retinal pigmented epithelium dorsal region absent, abnormal Fig. 2 with image from Rai et al., 2010
retinal pigmented epithelium dorsal region aplastic, abnormal Fig. 3 from Rai et al., 2006
whole organism pitx2 expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism gata5 expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism tbxta expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism id3 expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism dkk1b expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism cdh1 expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism fgf8a expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism dusp6 expression decreased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism lft2 expression increased amount, abnormal Fig. 4 from Wang et al., 2017
whole organism DNA methylation decreased process quality, abnormal Fig. 1 from Wang et al., 2017

Phenotype of all Fish created by or utilizing MO4-dnmt1
Phenotype Fish Conditions Figures
hemopoiesis disrupted, abnormal AB + MO4-dnmt1 standard conditions Fig. 4 from Deveau et al., 2015
myeloid cell lcp1 expression decreased amount, abnormal AB + MO4-dnmt1 standard conditions Fig. 4 from Deveau et al., 2015
DNA methylation on cytosine increased occurrence, abnormal WT + MO4-dnmt1 standard conditions Fig. 5 with image from Rai et al., 2010
pharyngeal arch 2 skeleton aplastic, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
forerunner cell group foxj1a expression decreased amount, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
forerunner cell group sox17 expression decreased amount, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
DNA methylation on cytosine decreased occurrence, abnormal WT + MO4-dnmt1 standard conditions text only from Rai et al., 2006
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 with image from Rai et al., 2010
exocrine pancreas undifferentiated, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 from Rai et al., 2006
exocrine pancreas development disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 from Rai et al., 2006
retinal pigmented epithelium dorsal region aplastic, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Rai et al., 2006
post-vent region curved ventral, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
retina disorganized, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Rai et al., 2006
retina layer formation disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 with image from Rai et al., 2010
histone H3-K9 methylation decreased occurrence, abnormal WT + MO4-dnmt1 standard conditions Fig. 4 from Rai et al., 2006
hematopoietic stem cell myb expression decreased distribution, abnormal WT + MO4-dnmt1 control Fig. 3 with imageFig. 5 with image from Liu et al., 2015
definitive hemopoiesis process quality, abnormal WT + MO4-dnmt1 control Fig. 3 with imageFig. 5 with image from Liu et al., 2015
intestinal epithelium undifferentiated, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 from Rai et al., 2006
retinal pigmented epithelium dorsal region absent, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 with image from Rai et al., 2010
intestinal epithelium gut endothelial cell absent, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
mandibular arch skeleton aplastic, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
pericardium edematous, abnormal WT + MO4-dnmt1 standard conditions Fig. 1 from Rai et al., 2006
camera-type eye photoreceptor cell differentiation disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 2 with image from Rai et al., 2010
retina development in camera-type eye disrupted, abnormal WT + MO4-dnmt1 standard conditions Fig. 3 from Rai et al., 2006
exocrine pancreas hypoplastic, abnormal gz15Tg + MO4-dnmt1 standard conditions Fig. 3 with image from Anderson et al., 2009
liver hypoplastic, abnormal gz15Tg + MO4-dnmt1 standard conditions Fig. 3 with image from Anderson et al., 2009
hepatocyte mislocalised posteriorly, abnormal gz15Tg + MO4-dnmt1 standard conditions Fig. 3 with image from Anderson et al., 2009
whole organism fgf8a expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism pitx2 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
forerunner cell group decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3Fig. 4 from Wang et al., 2017
Kupffer's vesicle cilium decreased length, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
whole organism id3 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
Kupffer's vesicle structure, cavities, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
whole organism gata5 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism lft2 expression increased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
Kupffer's vesicle decreased fluid flow, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
whole organism cdh1 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism DNA methylation decreased process quality, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 1 from Wang et al., 2017
forerunner cell group lft2 expression increased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism tbxta expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism dusp6 expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
whole organism dkk1b expression decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
Kupffer's vesicle cilium decreased amount, abnormal s870Tg + MO4-dnmt1 standard conditions Fig. 3 from Wang et al., 2017
heart looping process quality, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2Fig. 4 from Wang et al., 2017
heart tube position, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry process quality, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 4 from Wang et al., 2017
heart jogging disrupted, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
definitive hemopoiesis process quality, abnormal zf169Tg + MO4-dnmt1 control Fig. 4 with image from Liu et al., 2015
hematopoietic system posterior region EGFP expression decreased distribution, abnormal zf169Tg + MO4-dnmt1 control Fig. 4 with image from Liu et al., 2015
pancreas position, abnormal dnmt1s872/s872 ; gz15Tg ; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
determination of pancreatic left/right asymmetry disrupted, abnormal dnmt1s872/s872 ; gz15Tg ; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
determination of liver left/right asymmetry disrupted, abnormal dnmt1s872/s872 ; gz15Tg ; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
liver position, abnormal dnmt1s872/s872 ; gz15Tg ; m1018Tg + MO4-dnmt1 standard conditions Fig. EV2 from Wang et al., 2017
dorsal aorta hematopoietic stem cell runx1 expression amount, ameliorated hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
dorsal aorta hematopoietic stem cell myb expression amount, ameliorated hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
hemopoiesis process quality, ameliorated hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
myeloid cell lcp1 expression increased amount, abnormal hsi1Tg; zdf13Tg + MO4-dnmt1 heat shock Fig. 4 from Deveau et al., 2015
DNA methylation increased occurrence, abnormal WT + MO1-h2afvb + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism morphology, ameliorated WT + MO1-h2afvb + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism Ab1-h2afva labeling decreased amount, abnormal WT + MO1-h2afvb + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
whole organism decreased life span, abnormal WT + MO1-h2afvb + MO4-dnmt1 standard conditions Fig. 5 with image from Madakashira et al., 2017
forerunner cell group amount, ameliorated s870Tg + MO4-dnmt1 + MO4-lft2 standard conditions Fig. 4 from Wang et al., 2017
heart looping process quality, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart tube position, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart jogging disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart looping process quality, ameliorated twu34Tg + MO4-dnmt1 + MO4-lft2 standard conditions Fig. 4 from Wang et al., 2017
determination of heart left/right asymmetry process quality, ameliorated twu34Tg + MO4-dnmt1 + MO4-lft2 standard conditions Fig. 4 from Wang et al., 2017
liver decreased size, abnormal uhrf1hi272Tg + MO4-dnmt1 standard conditions Fig. 6 with image from Jacob et al., 2015
head morphology, abnormal uhrf1hi272Tg + MO4-dnmt1 standard conditions Fig. 6 with image from Jacob et al., 2015
Genome Resources:
CITATIONS (11)