header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-070326-7
Morpholino Name: MO1-rps19
Target: rps19 (1)
Sequence:
5' - CACTGTTACACCACCTGGCATCTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-rps19 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-rps19
Expressed Gene Anatomy Figures
alas2 Fig. S3 with image from Jia et al., 2013
baxa Fig. 3 from Torihara et al., 2011
bbc3 Fig. 3 from Torihara et al., 2011
cdkn1a Fig. 2 from Narla et al., 2014
Fig. 3 from Torihara et al., 2011
fzd5 Fig. S3 with image from Jia et al., 2013
gata1a Fig. S1 with image from Jia et al., 2013
Fig. 3 from Uechi et al., 2008
lcp1 Fig. 3 from Uechi et al., 2008
mdm2 Fig. 3 from Torihara et al., 2011
mpx Fig. 3 from Uechi et al., 2008
myb Fig. S1 with image from Jia et al., 2013
nrp1a Fig. S3 with image from Jia et al., 2013
runx1 Fig. S1 with image from Jia et al., 2013
spi1b Fig. 3 from Uechi et al., 2008
tagln Fig. S3 with image from Jia et al., 2013
tie1 Fig. 3 from Uechi et al., 2008
tp53 Fig. 2 from Narla et al., 2014
Fig. 3 from Torihara et al., 2011
PHENOTYPE
Phenotype resulting from MO1-rps19
Phenotype Figures
apoptotic process increased occurrence, abnormal Fig. 1 from Torihara et al., 2011
ball increased size, abnormal Fig. 3 with image from Uechi et al., 2006
brain segmentation disrupted, abnormal Fig. 1 from Uechi et al., 2008
cerebellum decreased thickness, abnormal Fig. 3 with image from Uechi et al., 2006
cranium edematous, abnormal Fig. 3 from Payne et al., 2012
extension decreased thickness, abnormal Fig. 1 from Uechi et al., 2008
Fig. 3 with image from Uechi et al., 2006
eye decreased size, abnormal Fig. 1 from Torihara et al., 2011
eye immature, abnormal Fig. 3 from Payne et al., 2012
fin aplastic, abnormal Fig. 3 with image from Uechi et al., 2006
forebrain morphology, abnormal Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal Fig. 3 with image from Uechi et al., 2006
head decreased size, abnormal Fig. 1 from Torihara et al., 2011
heart edematous, abnormal Fig. 3 from Payne et al., 2012
hemopoiesis process quality, abnormal Fig. 4 with image from Zhang et al., 2013
hindbrain opaque, abnormal Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal Fig. 3 with image from Uechi et al., 2006
lens absent, abnormal Fig. 3 from Payne et al., 2012
midbrain hindbrain boundary aplastic, abnormal Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte apoptotic, abnormal Fig. 1 from Torihara et al., 2011
nucleate erythrocyte decreased amount, abnormal Fig. 1 with image from Narla et al., 2014
Fig. 1 with image from Jia et al., 2013
Fig. 1Fig. S1 from Payne et al., 2012
Fig. 2 from Torihara et al., 2011
Fig. 2 from Uechi et al., 2008
Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte hemoglobin complex decreased amount, abnormal Fig. 1 with image from Narla et al., 2014
optic tectum aplastic, abnormal Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal Fig. 3 with image from Uechi et al., 2006
otic placode aplastic, abnormal Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal Fig. 3 with image from Uechi et al., 2006
otic vesicle decreased size, abnormal Fig. 1 from Uechi et al., 2008
otolith organ decreased size, abnormal Fig. 3 with image from Uechi et al., 2006
pharyngeal arch 3-7 immature, abnormal Fig. 1 from Payne et al., 2012
post-vent region bent, abnormal Fig. 3 with image from Uechi et al., 2006
post-vent region curved ventral, abnormal Fig. 1 with image from Jia et al., 2013
Fig. 1 from Uechi et al., 2008
post-vent region kinked, abnormal Fig. 1 from Payne et al., 2012
retina decreased size, abnormal Fig. 3 with image from Uechi et al., 2006
tegmentum opaque, abnormal Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal Fig. 1 from Payne et al., 2012
Fig. 1 from Torihara et al., 2011
whole organism tp53 expression increased amount, abnormal Fig. 2 from Narla et al., 2014
whole organism cdkn1a expression increased amount, abnormal Fig. 2 from Narla et al., 2014

Phenotype of all Fish created by or utilizing MO1-rps19
Phenotype Fish Conditions Figures
fin aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
heart edematous, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
whole organism tp53 expression increased amount, abnormal AB + MO1-rps19 standard conditions Fig. 2 from Narla et al., 2014
pharyngeal arch 3-7 immature, abnormal AB + MO1-rps19 standard conditions Fig. 1 from Payne et al., 2012
tegmentum opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
otolith organ decreased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal AB + MO1-rps19 standard conditions Fig. 1 from Payne et al., 2012
fourth ventricle increased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 1Fig. S1 from Payne et al., 2012
Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region kinked, abnormal AB + MO1-rps19 standard conditions Fig. 1 from Payne et al., 2012
extension decreased thickness, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain morphology, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
cerebellum decreased thickness, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism tp53 expression increased amount, abnormal AB + MO1-rps19 chemical treatment: L-leucine Fig. 2 from Narla et al., 2014
cranium edematous, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
nucleate erythrocyte hemoglobin complex decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 1 with image from Narla et al., 2014
optic tectum aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
eye immature, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
whole organism cdkn1a expression increased amount, abnormal AB + MO1-rps19 standard conditions Fig. 2 from Narla et al., 2014
lens absent, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
whole organism cdkn1a expression increased amount, abnormal AB + MO1-rps19 chemical treatment: L-leucine Fig. 2 from Narla et al., 2014
otic placode aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
eye decreased size, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
hemopoiesis process quality, abnormal WT + MO1-rps19 standard conditions Fig. 4 with image from Zhang et al., 2013
head decreased size, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
otic vesicle decreased size, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Uechi et al., 2008
nucleate erythrocyte apoptotic, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
brain segmentation disrupted, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Uechi et al., 2008
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps19 standard conditions Fig. 1 with image from Jia et al., 2013
Fig. 2 from Torihara et al., 2011
Fig. 2 from Uechi et al., 2008
post-vent region curved ventral, abnormal WT + MO1-rps19 standard conditions Fig. 1 with image from Jia et al., 2013
Fig. 1 from Uechi et al., 2008
whole organism decreased length, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
extension decreased thickness, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Uechi et al., 2008
apoptotic process increased occurrence, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps19 + MO4-tp53 standard conditions Fig. 2 from Torihara et al., 2011
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-rps19 standard conditions Fig. 1 with image from Narla et al., 2014
nucleate erythrocyte hemoglobin complex decreased amount, abnormal tp53zdf1/zdf1 + MO1-rps19 standard conditions Fig. 1 with image from Narla et al., 2014
OTHER MO1-rps19 MORPHOLINO PAGESNo links to external sites
CITATIONS (9)