header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060705-5
Morpholino Name: MO1-tcf7l1a
Target: tcf7l1a (1)
Previous Names: hdl MO (1), tcf3a Mo (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CTCCGTTTAACTGAGGCATGTTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tcf7l1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tcf7l1a
Expressed Gene Anatomy Figures
fabp2 Fig. 6 with image from Faro et al., 2009
fabp10a Fig. 6 with image from Faro et al., 2009
pax2a Fig. 7 from Cavodeassi et al., 2005
prss1 Fig. 6 with image from Faro et al., 2009
rx3 Fig. 7 from Cavodeassi et al., 2005
wnt1 Fig. 1 from Domené et al., 2008
PHENOTYPE
Phenotype resulting from MO1-tcf7l1a
Phenotype of all Fish created by or utilizing MO1-tcf7l1a
Phenotype Fish Conditions Figures
eye aplastic, abnormal AB + MO1-tcf7l1a standard conditions Fig. 1 from Domené et al., 2008
head anterior region truncated, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye hypoplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head morphogenesis disrupted, abnormal WT + MO1-tcf7l1a standard conditions Fig. S1 with image from Faro et al., 2009
eye aplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
eye decreased size, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head malformed, abnormal WT + MO1-tcf7l1a standard conditions Fig. S1 with image from Faro et al., 2009
telencephalon aplastic, abnormal WT + MO1-tcf7l1a standard conditions Fig. 3 from Dorsky et al., 2003
Fig. 2 with image from Dorsky et al., 2002
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
hepatocyte differentiation disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
endodermal digestive tract morphogenesis disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
exocrine pancreas development disrupted, abnormal apchu745/hu745 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
head decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
brain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
telencephalon aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tcf7l1b standard conditions Fig. 3 from Dorsky et al., 2003
whole organism wholly dorsalized, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye absent, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head anterior region truncated, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
forebrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
notochord aplastic/hypoplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbga standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
cardiac ventricle has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
atrium has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart has extra parts of type cardiac muscle cell, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart increased size, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
heart linear, abnormal f2Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 1 with image from Sorrell et al., 2013
cranial vasculature anterior region absent, abnormal s843Tg + MO1-tcf7l1a + MO1-tcf7l1b + MO4-tp53 standard conditions Fig. 9 with image from Sorrell et al., 2013
exocrine pancreas development disrupted, abnormal apchu745/hu745; tcf7hu3238/hu3238 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
endodermal digestive tract morphogenesis disrupted, abnormal apchu745/hu745; tcf7hu3238/hu3238 + MO1-tcf7l1a standard conditions Fig. 6 with image from Faro et al., 2009
Genome Resources:
CITATIONS (15)