header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060405-1
Morpholino Name: MO7-tal1
Target: tal1 (1)
Previous Name: slc UTR-MO

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTCGGATTTCAGTTTTTCCATCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking Morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO7-tal1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO7-tal1
Expressed Gene Anatomy Figures
dlc Fig. S2 with image from Qian et al., 2007
etv2 Fig. 7 with image from Sumanas et al., 2006
gata1a Fig. 4 from Xiong et al., 2008
Fig. 3 with image from Qian et al., 2007
Fig. 7 with image from Sumanas et al., 2006
hbbe1.1 Fig. 3 with image from Qian et al., 2007
hey2 Fig. S2 with image from Qian et al., 2007
myb Fig. 6 with image from Zhen et al., 2013
Fig. 6 with image from Qian et al., 2007
pax2a Fig. S5 with image from Mudumana et al., 2008
rag1 Fig. S6 with image from Zhen et al., 2013
Fig. 6 with image from Qian et al., 2007
runx1 Fig. 6 with image from Qian et al., 2007
spi1b Fig. 4 from Sumanas et al., 2008
Fig. 3 with image from Qian et al., 2007
tal1 Fig. 3 with imageFig. 7 with image from Qian et al., 2007
PHENOTYPE
Phenotype resulting from MO7-tal1
Phenotype of all Fish created by or utilizing MO7-tal1
OTHER MO7-tal1 MORPHOLINO PAGES No links to external sites
CITATIONS (6)