ZFIN ID: ZDB-MRPHLNO-060113-1
Morpholino Name: MO1-gna13b
Target: gna13b (1)
Previous Name: gna13b-MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGGAAATACGCCATCTTTGTGCAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gna13b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gna13b No data available
PHENOTYPE
Phenotype resulting from MO1-gna13b
No data available

Phenotype of all Fish created by or utilizing MO1-gna13b
Phenotype Fish Conditions Figures
caudal fin blistered, abnormal WT + MO1-gna13a + MO1-gna13b standard conditions Fig. 1 with image from Ye et al., 2013
pericardium edematous, abnormal WT + MO1-gna13a + MO1-gna13b standard conditions Fig. 1 with image from Ye et al., 2013
myocardium unfused from myocardium, abnormal WT + MO1-gna13a + MO1-gna13b standard conditions Fig. 8 with image from Xie et al., 2016
endocardium unfused from endocardium, abnormal WT + MO1-gna13a + MO1-gna13b standard conditions Fig. 1 with image from Xie et al., 2016
heart duplicated, abnormal WT + MO1-gna13a + MO1-gna13b standard conditions Fig. S1 with image from Ye et al., 2013
endothelial cell absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell cdh5 expression absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
myocardium fused with myocardium, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
myelination of posterior lateral line nerve axons disrupted, abnormal WT + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 from Ackerman et al., 2018
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. 1Fig. 6 from Lin et al., 2009
heart duplicated, abnormal WT + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. S1 with image from Ye et al., 2013
myelination of posterior lateral line nerve axons disrupted, abnormal adgrg1stl13/+ + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 from Ackerman et al., 2018
spinal cord oligodendrocyte development decreased occurrence, abnormal adgrg1stl13/+ + MO1-gna12a + MO1-gna13a + MO1-gna13b(AB) standard conditions Fig. 7 from Ackerman et al., 2015
myelination of posterior lateral line nerve axons disrupted, abnormal adgrg1stl13/stl13 + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 from Ackerman et al., 2018
spinal cord oligodendrocyte development decreased occurrence, abnormal adgrg1stl13/stl13 + MO1-gna12a + MO1-gna13a + MO1-gna13b(AB) standard conditions Fig. 7 from Ackerman et al., 2015
endoderm anterior region perforate, abnormal ha01Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Ye et al., 2013
endoderm anterior region increased width, abnormal ha01Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Ye et al., 2013
endocardium unfused from endocardium, abnormal is1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 6 with image from Xie et al., 2016
endocardium disorganized, abnormal is1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 6 with image from Xie et al., 2016
endocardium structure, abnormal is1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 6 with image from Xie et al., 2016
endocardium loose, abnormal is1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 6 with image from Xie et al., 2016
heart duplicated, abnormal twu34Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 1 with imageFig. S1 with image from Ye et al., 2013
heart duplicated, abnormal twu34Tg + MO1-gna12a + MO1-gna13a + MO1-gna13b standard conditions Fig. S1 with image from Ye et al., 2013
myocardial precursor anatomical region ab2-fn labeling spatial pattern, abnormal fb7Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 7 with image from Xie et al., 2016
endocardial precursor anatomical region ab2-fn labeling spatial pattern, abnormal fb7Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 7 with image from Xie et al., 2016
endocardial progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal fb9Tg ; y1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with imageFig. 8 with image from Xie et al., 2016
endocardial precursor cardioblast migration to the midline involved in heart field formation decreased occurrence, abnormal fb9Tg ; y1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with imageFig. 8 with image from Xie et al., 2016
endocardial precursor mislocalised, abnormal fb9Tg ; y1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation decreased occurrence, abnormal fb9Tg ; y1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with imageFig. 8 with image from Xie et al., 2016
endocardium cardioblast migration process quality, abnormal fb9Tg ; y1Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with image from Xie et al., 2016
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with image from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 2 with image from Fukui et al., 2014
endoderm anterior region increased width, abnormal ha01Tg; twu34Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 7 with image from Ye et al., 2013
endoderm anterior region perforate, abnormal ha01Tg; twu34Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 7 with image from Ye et al., 2013
heart duplicated, abnormal ha01Tg; twu34Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 7 with image from Ye et al., 2013
endocardium mislocalised, abnormal ui6Tg ; is5Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 1 with image from Xie et al., 2016
endocardial precursor anatomical side ab2-fn labeling spatial pattern, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Xie et al., 2016
endocardial precursor fibronectin fibril disorganized, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Xie et al., 2016
endocardial progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 with image from Xie et al., 2016
endocardial precursor cardioblast migration to the midline involved in heart field formation decreased occurrence, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 with image from Xie et al., 2016
endoderm cell migration process quality, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 with image from Xie et al., 2016
endocardial precursor fibronectin fibril disoriented, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Xie et al., 2016
endocardial precursor cell trailing edge ab2-fn labeling increased amount, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Xie et al., 2016
endocardial precursor cell leading edge ab2-fn labeling decreased amount, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Xie et al., 2016
endoderm cell migration decreased occurrence, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 3 with image from Xie et al., 2016
endocardium cardioblast migration process quality, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 4 with image from Xie et al., 2016
endocardial precursor fibronectin fibril organization decreased occurrence, abnormal y1Tg ; ui3Tg + MO1-gna13a + MO1-gna13b standard conditions Fig. 5 with image from Xie et al., 2016
endothelial cell absent, abnormal fb9Tg ; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell EGFP expression absent, abnormal fb9Tg ; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated fb9Tg ; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etv2 standard conditions Fig. 8 with image from Xie et al., 2016
endoderm antero-medial region decreased object quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
heart tube split bilaterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a standard conditions Fig. 2 with image from Fukui et al., 2014
Genome Resources:
CITATIONS (9)