Morpholino

MO3-plcg1

ID
ZDB-MRPHLNO-051214-1
Name
MO3-plcg1
Previous Names
  • MO4-plcg1
Target
Sequence
5' - ATTAGCATAGGGAACTTACTTTCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino sequence is based on sequence of the intron-exon boundaries of the plcg1 gene in the Tg(fli1:EGFP)y1 (EK) line. The mismatch with Ensembl builds (Zv5, Zv8) may reflect a polymorphism.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-plcg1
Phenotype
Phenotype resulting from MO3-plcg1
Phenotype of all Fish created by or utilizing MO3-plcg1
Phenotype Fish Conditions Figures
intersegmental vessel aplastic, abnormal WT + MO3-plcg1 standard conditions Fig. 2Fig. 3 from Herbert et al., 2009
blood circulation arrested, abnormal WT + MO3-plcg1 standard conditions Fig. 1 from Ma et al., 2007
heart edematous, abnormal WT + MO3-plcg1 standard conditions Fig. 1 from Ma et al., 2007
angiogenesis disrupted, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
dorsal aorta aplastic, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Herbert et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO3-plcg1 standard conditions Fig. 1 from Ma et al., 2007
sprouting angiogenesis disrupted, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Herbert et al., 2009
blood vessel morphogenesis disrupted, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Herbert et al., 2009
artery aplastic, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 4 from Pan et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 4 from Pan et al., 2012
ventral wall of dorsal aorta hematopoietic stem cell absent, abnormal kca3Tg; kca4Tg + MO3-plcg1 standard conditions Fig. 4 from Burns et al., 2009
hematopoietic stem cell differentiation disrupted, abnormal kca3Tg; kca4Tg + MO3-plcg1 standard conditions Fig. 4 from Burns et al., 2009
parachordal vessel immature, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
branching involved in lymph vessel morphogenesis process quality, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
venous blood vessel morphogenesis disrupted, abnormal WT + MO1-flt4 + MO3-plcg1 standard conditions Fig. 3 from Herbert et al., 2009
intersegmental vessel aplastic, abnormal WT + MO1-flt4 + MO3-plcg1 standard conditions Fig. 3 from Herbert et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg ; svep1hu4767/+ + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
artery development disrupted, abnormal y1Tg ; svep1hu4767/+ + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg ; svep1hu4767/hu4767 + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
artery development disrupted, abnormal y1Tg ; svep1hu4767/hu4767 + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
Citations